ID: 925896519

View in Genome Browser
Species Human (GRCh38)
Location 2:8476526-8476548
Sequence GTTGGCACAGGGCTAGTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925896519_925896528 21 Left 925896519 2:8476526-8476548 CCGTGGACTAGCCCTGTGCCAAC No data
Right 925896528 2:8476570-8476592 GAGCCAATTCACCCACTTGGAGG No data
925896519_925896523 -10 Left 925896519 2:8476526-8476548 CCGTGGACTAGCCCTGTGCCAAC No data
Right 925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG No data
925896519_925896525 -2 Left 925896519 2:8476526-8476548 CCGTGGACTAGCCCTGTGCCAAC No data
Right 925896525 2:8476547-8476569 ACAGCAGGAATGAGGTGATATGG No data
925896519_925896527 18 Left 925896519 2:8476526-8476548 CCGTGGACTAGCCCTGTGCCAAC No data
Right 925896527 2:8476567-8476589 TGGGAGCCAATTCACCCACTTGG No data
925896519_925896526 -1 Left 925896519 2:8476526-8476548 CCGTGGACTAGCCCTGTGCCAAC No data
Right 925896526 2:8476548-8476570 CAGCAGGAATGAGGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925896519 Original CRISPR GTTGGCACAGGGCTAGTCCA CGG (reversed) Intergenic
No off target data available for this crispr