ID: 925896523

View in Genome Browser
Species Human (GRCh38)
Location 2:8476539-8476561
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925896519_925896523 -10 Left 925896519 2:8476526-8476548 CCGTGGACTAGCCCTGTGCCAAC No data
Right 925896523 2:8476539-8476561 CTGTGCCAACAGCAGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr