ID: 925901794

View in Genome Browser
Species Human (GRCh38)
Location 2:8514094-8514116
Sequence CCCCTCCCCGCTGCCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925901794_925901798 7 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901798 2:8514124-8514146 GCAGAATTAGGATGGCGCTGAGG No data
925901794_925901800 11 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901800 2:8514128-8514150 AATTAGGATGGCGCTGAGGGAGG No data
925901794_925901797 -1 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG No data
925901794_925901802 15 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901802 2:8514132-8514154 AGGATGGCGCTGAGGGAGGCGGG No data
925901794_925901801 14 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901801 2:8514131-8514153 TAGGATGGCGCTGAGGGAGGCGG No data
925901794_925901803 24 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901803 2:8514141-8514163 CTGAGGGAGGCGGGATAGCTCGG No data
925901794_925901796 -5 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901796 2:8514112-8514134 AGGGGATGAGAAGCAGAATTAGG No data
925901794_925901799 8 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901799 2:8514125-8514147 CAGAATTAGGATGGCGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925901794 Original CRISPR CCCCTCCCCGCTGCCCCACA TGG (reversed) Intergenic
No off target data available for this crispr