ID: 925901797

View in Genome Browser
Species Human (GRCh38)
Location 2:8514116-8514138
Sequence GATGAGAAGCAGAATTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925901782_925901797 25 Left 925901782 2:8514068-8514090 CCAGGAGACAGAGGGTGAGGCGG No data
Right 925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG No data
925901794_925901797 -1 Left 925901794 2:8514094-8514116 CCATGTGGGGCAGCGGGGAGGGG No data
Right 925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG No data
925901792_925901797 0 Left 925901792 2:8514093-8514115 CCCATGTGGGGCAGCGGGGAGGG No data
Right 925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925901797 Original CRISPR GATGAGAAGCAGAATTAGGA TGG Intergenic
No off target data available for this crispr