ID: 925901901

View in Genome Browser
Species Human (GRCh38)
Location 2:8514796-8514818
Sequence CTGTCTGTGCAGAGCTAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925901893_925901901 30 Left 925901893 2:8514743-8514765 CCCTTCATGGAGGCTCTCAGGCA No data
Right 925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG No data
925901896_925901901 -7 Left 925901896 2:8514780-8514802 CCCTTTCCCTCTCCATCTGTCTG No data
Right 925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG No data
925901895_925901901 -4 Left 925901895 2:8514777-8514799 CCTCCCTTTCCCTCTCCATCTGT No data
Right 925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG No data
925901894_925901901 29 Left 925901894 2:8514744-8514766 CCTTCATGGAGGCTCTCAGGCAG No data
Right 925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG No data
925901897_925901901 -8 Left 925901897 2:8514781-8514803 CCTTTCCCTCTCCATCTGTCTGT No data
Right 925901901 2:8514796-8514818 CTGTCTGTGCAGAGCTAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925901901 Original CRISPR CTGTCTGTGCAGAGCTAGCA CGG Intergenic
No off target data available for this crispr