ID: 925903605

View in Genome Browser
Species Human (GRCh38)
Location 2:8525784-8525806
Sequence CCACGTTGCTGGGCAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925903595_925903605 -6 Left 925903595 2:8525767-8525789 CCGTGGCCTCCCACGCCCCACGT No data
Right 925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG No data
925903591_925903605 30 Left 925903591 2:8525731-8525753 CCAACAGCGCTAAAGCTACAGCC No data
Right 925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG No data
925903594_925903605 4 Left 925903594 2:8525757-8525779 CCGCAGAGAGCCGTGGCCTCCCA No data
Right 925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG No data
925903593_925903605 9 Left 925903593 2:8525752-8525774 CCAAGCCGCAGAGAGCCGTGGCC No data
Right 925903605 2:8525784-8525806 CCACGTTGCTGGGCAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925903605 Original CRISPR CCACGTTGCTGGGCAGAGAA GGG Intergenic
No off target data available for this crispr