ID: 925907486

View in Genome Browser
Species Human (GRCh38)
Location 2:8547973-8547995
Sequence GGGATGGTGGGAGAGGAATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925907486_925907500 24 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907500 2:8548020-8548042 GGGCCACATCCTCCCTCCCAGGG No data
925907486_925907497 4 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907497 2:8548000-8548022 GCTGTCTGCAGTCCTCATATGGG No data
925907486_925907499 23 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907486_925907502 30 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG No data
925907486_925907496 3 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925907486 Original CRISPR GGGATGGTGGGAGAGGAATC CGG (reversed) Intergenic
No off target data available for this crispr