ID: 925907488

View in Genome Browser
Species Human (GRCh38)
Location 2:8547980-8548002
Sequence AGCCAGGGGGATGGTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925907488_925907496 -4 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907488_925907500 17 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907500 2:8548020-8548042 GGGCCACATCCTCCCTCCCAGGG No data
925907488_925907503 24 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907503 2:8548027-8548049 ATCCTCCCTCCCAGGGTTTAGGG No data
925907488_925907502 23 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG No data
925907488_925907497 -3 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907497 2:8548000-8548022 GCTGTCTGCAGTCCTCATATGGG No data
925907488_925907504 25 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907504 2:8548028-8548050 TCCTCCCTCCCAGGGTTTAGGGG No data
925907488_925907499 16 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925907488 Original CRISPR AGCCAGGGGGATGGTGGGAG AGG (reversed) Intergenic
No off target data available for this crispr