ID: 925907494

View in Genome Browser
Species Human (GRCh38)
Location 2:8547995-8548017
Sequence ATGAGGACTGCAGACAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925907494_925907502 8 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG No data
925907494_925907499 1 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907494_925907504 10 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907504 2:8548028-8548050 TCCTCCCTCCCAGGGTTTAGGGG No data
925907494_925907510 30 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907510 2:8548048-8548070 GGGATGTCATTGTCTCTGCCTGG No data
925907494_925907500 2 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907500 2:8548020-8548042 GGGCCACATCCTCCCTCCCAGGG No data
925907494_925907503 9 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907503 2:8548027-8548049 ATCCTCCCTCCCAGGGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925907494 Original CRISPR ATGAGGACTGCAGACAGCCA GGG (reversed) Intergenic
No off target data available for this crispr