ID: 925907496

View in Genome Browser
Species Human (GRCh38)
Location 2:8547999-8548021
Sequence GGCTGTCTGCAGTCCTCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925907484_925907496 18 Left 925907484 2:8547958-8547980 CCGTGGCCTCTCTCTCCGGATTC No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907490_925907496 -10 Left 925907490 2:8547986-8548008 CCACCATCCCCCTGGCTGTCTGC No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907489_925907496 -9 Left 925907489 2:8547985-8548007 CCCACCATCCCCCTGGCTGTCTG No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907488_925907496 -4 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907485_925907496 12 Left 925907485 2:8547964-8547986 CCTCTCTCTCCGGATTCCTCTCC No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907482_925907496 23 Left 925907482 2:8547953-8547975 CCTGGCCGTGGCCTCTCTCTCCG No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data
925907486_925907496 3 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907496 2:8547999-8548021 GGCTGTCTGCAGTCCTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925907496 Original CRISPR GGCTGTCTGCAGTCCTCATA TGG Intergenic
No off target data available for this crispr