ID: 925907498

View in Genome Browser
Species Human (GRCh38)
Location 2:8548012-8548034
Sequence GGGAGGATGTGGCCCATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925907498_925907510 13 Left 925907498 2:8548012-8548034 CCTCATATGGGCCACATCCTCCC No data
Right 925907510 2:8548048-8548070 GGGATGTCATTGTCTCTGCCTGG No data
925907498_925907503 -8 Left 925907498 2:8548012-8548034 CCTCATATGGGCCACATCCTCCC No data
Right 925907503 2:8548027-8548049 ATCCTCCCTCCCAGGGTTTAGGG No data
925907498_925907504 -7 Left 925907498 2:8548012-8548034 CCTCATATGGGCCACATCCTCCC No data
Right 925907504 2:8548028-8548050 TCCTCCCTCCCAGGGTTTAGGGG No data
925907498_925907502 -9 Left 925907498 2:8548012-8548034 CCTCATATGGGCCACATCCTCCC No data
Right 925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925907498 Original CRISPR GGGAGGATGTGGCCCATATG AGG (reversed) Intergenic
No off target data available for this crispr