ID: 925907499

View in Genome Browser
Species Human (GRCh38)
Location 2:8548019-8548041
Sequence TGGGCCACATCCTCCCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925907495_925907499 0 Left 925907495 2:8547996-8548018 CCTGGCTGTCTGCAGTCCTCATA No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907492_925907499 3 Left 925907492 2:8547993-8548015 CCCCCTGGCTGTCTGCAGTCCTC No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907494_925907499 1 Left 925907494 2:8547995-8548017 CCCTGGCTGTCTGCAGTCCTCAT No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907486_925907499 23 Left 925907486 2:8547973-8547995 CCGGATTCCTCTCCCACCATCCC No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907493_925907499 2 Left 925907493 2:8547994-8548016 CCCCTGGCTGTCTGCAGTCCTCA No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907488_925907499 16 Left 925907488 2:8547980-8548002 CCTCTCCCACCATCCCCCTGGCT No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907490_925907499 10 Left 925907490 2:8547986-8548008 CCACCATCCCCCTGGCTGTCTGC No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907491_925907499 7 Left 925907491 2:8547989-8548011 CCATCCCCCTGGCTGTCTGCAGT No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data
925907489_925907499 11 Left 925907489 2:8547985-8548007 CCCACCATCCCCCTGGCTGTCTG No data
Right 925907499 2:8548019-8548041 TGGGCCACATCCTCCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925907499 Original CRISPR TGGGCCACATCCTCCCTCCC AGG Intergenic
No off target data available for this crispr