ID: 925909911

View in Genome Browser
Species Human (GRCh38)
Location 2:8566943-8566965
Sequence GAGCCATCTCACCTATTGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925909909_925909911 -2 Left 925909909 2:8566922-8566944 CCGTGACCATAAATTGTTGGTGA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 925909911 2:8566943-8566965 GAGCCATCTCACCTATTGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 86
925909907_925909911 2 Left 925909907 2:8566918-8566940 CCTTCCGTGACCATAAATTGTTG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 925909911 2:8566943-8566965 GAGCCATCTCACCTATTGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 86
925909906_925909911 18 Left 925909906 2:8566902-8566924 CCTGGGAGGAAGCTCACCTTCCG 0: 1
1: 0
2: 2
3: 8
4: 127
Right 925909911 2:8566943-8566965 GAGCCATCTCACCTATTGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 86
925909910_925909911 -8 Left 925909910 2:8566928-8566950 CCATAAATTGTTGGTGAGCCATC 0: 1
1: 0
2: 1
3: 7
4: 60
Right 925909911 2:8566943-8566965 GAGCCATCTCACCTATTGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925909911 Original CRISPR GAGCCATCTCACCTATTGTG CGG Intergenic