ID: 925913110

View in Genome Browser
Species Human (GRCh38)
Location 2:8586211-8586233
Sequence CTGAGGAAACAGAAGCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925913104_925913110 23 Left 925913104 2:8586165-8586187 CCAGTGCACCTGACATGCAACAA No data
Right 925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG No data
925913105_925913110 15 Left 925913105 2:8586173-8586195 CCTGACATGCAACAAGAGCTTGA No data
Right 925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG No data
925913107_925913110 -10 Left 925913107 2:8586198-8586220 CCGCGTCACCTTCCTGAGGAAAC No data
Right 925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925913110 Original CRISPR CTGAGGAAACAGAAGCATGA CGG Intergenic
No off target data available for this crispr