ID: 925913183

View in Genome Browser
Species Human (GRCh38)
Location 2:8586652-8586674
Sequence CTGGACATCCTGAAGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925913183_925913198 29 Left 925913183 2:8586652-8586674 CCATTCCCCTTCAGGATGTCCAG No data
Right 925913198 2:8586704-8586726 GAACTCGCATTTGACCCCTGGGG No data
925913183_925913197 28 Left 925913183 2:8586652-8586674 CCATTCCCCTTCAGGATGTCCAG No data
Right 925913197 2:8586703-8586725 GGAACTCGCATTTGACCCCTGGG No data
925913183_925913196 27 Left 925913183 2:8586652-8586674 CCATTCCCCTTCAGGATGTCCAG No data
Right 925913196 2:8586702-8586724 TGGAACTCGCATTTGACCCCTGG No data
925913183_925913192 7 Left 925913183 2:8586652-8586674 CCATTCCCCTTCAGGATGTCCAG No data
Right 925913192 2:8586682-8586704 GGACCGGCCTCTTCCAAAAGTGG No data
925913183_925913199 30 Left 925913183 2:8586652-8586674 CCATTCCCCTTCAGGATGTCCAG No data
Right 925913199 2:8586705-8586727 AACTCGCATTTGACCCCTGGGGG No data
925913183_925913190 -9 Left 925913183 2:8586652-8586674 CCATTCCCCTTCAGGATGTCCAG No data
Right 925913190 2:8586666-8586688 GATGTCCAGCTGGGCTGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925913183 Original CRISPR CTGGACATCCTGAAGGGGAA TGG (reversed) Intergenic
No off target data available for this crispr