ID: 925915818

View in Genome Browser
Species Human (GRCh38)
Location 2:8604986-8605008
Sequence TTTAATAAGTAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925915818_925915822 12 Left 925915818 2:8604986-8605008 CCTGCCTCCTTCTACTTATTAAA No data
Right 925915822 2:8605021-8605043 ACTATAAAACAGCCCCAGGCAGG No data
925915818_925915823 21 Left 925915818 2:8604986-8605008 CCTGCCTCCTTCTACTTATTAAA No data
Right 925915823 2:8605030-8605052 CAGCCCCAGGCAGGTCCATCAGG No data
925915818_925915821 8 Left 925915818 2:8604986-8605008 CCTGCCTCCTTCTACTTATTAAA No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925915818 Original CRISPR TTTAATAAGTAGAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr