ID: 925915821

View in Genome Browser
Species Human (GRCh38)
Location 2:8605017-8605039
Sequence GTTAACTATAAAACAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925915820_925915821 1 Left 925915820 2:8604993-8605015 CCTTCTACTTATTAAAAAGCAAA No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data
925915819_925915821 4 Left 925915819 2:8604990-8605012 CCTCCTTCTACTTATTAAAAAGC No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data
925915815_925915821 17 Left 925915815 2:8604977-8604999 CCACCGCACCCTGCCTCCTTCTA No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data
925915818_925915821 8 Left 925915818 2:8604986-8605008 CCTGCCTCCTTCTACTTATTAAA No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data
925915817_925915821 9 Left 925915817 2:8604985-8605007 CCCTGCCTCCTTCTACTTATTAA No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data
925915814_925915821 23 Left 925915814 2:8604971-8604993 CCTGAGCCACCGCACCCTGCCTC No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data
925915816_925915821 14 Left 925915816 2:8604980-8605002 CCGCACCCTGCCTCCTTCTACTT No data
Right 925915821 2:8605017-8605039 GTTAACTATAAAACAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925915821 Original CRISPR GTTAACTATAAAACAGCCCC AGG Intergenic
No off target data available for this crispr