ID: 925916674

View in Genome Browser
Species Human (GRCh38)
Location 2:8611921-8611943
Sequence ACAAGGGCTTTCAGCGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925916674_925916681 15 Left 925916674 2:8611921-8611943 CCTTGAACGCTGAAAGCCCTTGT No data
Right 925916681 2:8611959-8611981 ACAAAAGCAATATATCTTCCTGG No data
925916674_925916677 -10 Left 925916674 2:8611921-8611943 CCTTGAACGCTGAAAGCCCTTGT No data
Right 925916677 2:8611934-8611956 AAGCCCTTGTGGTGTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925916674 Original CRISPR ACAAGGGCTTTCAGCGTTCA AGG (reversed) Intergenic
No off target data available for this crispr