ID: 925916677

View in Genome Browser
Species Human (GRCh38)
Location 2:8611934-8611956
Sequence AAGCCCTTGTGGTGTTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925916674_925916677 -10 Left 925916674 2:8611921-8611943 CCTTGAACGCTGAAAGCCCTTGT No data
Right 925916677 2:8611934-8611956 AAGCCCTTGTGGTGTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925916677 Original CRISPR AAGCCCTTGTGGTGTTGCCT GGG Intergenic
No off target data available for this crispr