ID: 925916679

View in Genome Browser
Species Human (GRCh38)
Location 2:8611938-8611960
Sequence GTGACCCAGGCAACACCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925916679_925916681 -2 Left 925916679 2:8611938-8611960 CCTTGTGGTGTTGCCTGGGTCAC No data
Right 925916681 2:8611959-8611981 ACAAAAGCAATATATCTTCCTGG No data
925916679_925916682 15 Left 925916679 2:8611938-8611960 CCTTGTGGTGTTGCCTGGGTCAC No data
Right 925916682 2:8611976-8611998 TCCTGGAGTGATGCTTTTATAGG No data
925916679_925916684 24 Left 925916679 2:8611938-8611960 CCTTGTGGTGTTGCCTGGGTCAC No data
Right 925916684 2:8611985-8612007 GATGCTTTTATAGGTTACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925916679 Original CRISPR GTGACCCAGGCAACACCACA AGG (reversed) Intergenic
No off target data available for this crispr