ID: 925916681

View in Genome Browser
Species Human (GRCh38)
Location 2:8611959-8611981
Sequence ACAAAAGCAATATATCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925916679_925916681 -2 Left 925916679 2:8611938-8611960 CCTTGTGGTGTTGCCTGGGTCAC No data
Right 925916681 2:8611959-8611981 ACAAAAGCAATATATCTTCCTGG No data
925916674_925916681 15 Left 925916674 2:8611921-8611943 CCTTGAACGCTGAAAGCCCTTGT No data
Right 925916681 2:8611959-8611981 ACAAAAGCAATATATCTTCCTGG No data
925916678_925916681 -1 Left 925916678 2:8611937-8611959 CCCTTGTGGTGTTGCCTGGGTCA No data
Right 925916681 2:8611959-8611981 ACAAAAGCAATATATCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925916681 Original CRISPR ACAAAAGCAATATATCTTCC TGG Intergenic
No off target data available for this crispr