ID: 925917150

View in Genome Browser
Species Human (GRCh38)
Location 2:8614910-8614932
Sequence TGGAGAATGAGCAGGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925917138_925917150 11 Left 925917138 2:8614876-8614898 CCCACCTGACTACGCCAGGAGGA No data
Right 925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG No data
925917144_925917150 -3 Left 925917144 2:8614890-8614912 CCAGGAGGACTTGGGGCACTTGG No data
Right 925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG No data
925917139_925917150 10 Left 925917139 2:8614877-8614899 CCACCTGACTACGCCAGGAGGAC No data
Right 925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG No data
925917140_925917150 7 Left 925917140 2:8614880-8614902 CCTGACTACGCCAGGAGGACTTG No data
Right 925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG No data
925917135_925917150 16 Left 925917135 2:8614871-8614893 CCTAGCCCACCTGACTACGCCAG No data
Right 925917150 2:8614910-8614932 TGGAGAATGAGCAGGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925917150 Original CRISPR TGGAGAATGAGCAGGACTGG GGG Intergenic
No off target data available for this crispr