ID: 925918596

View in Genome Browser
Species Human (GRCh38)
Location 2:8624373-8624395
Sequence CACCAAGGGCTGCTCTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925918587_925918596 15 Left 925918587 2:8624335-8624357 CCAGGGCTCCGAGGCACAGGCAA No data
Right 925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG No data
925918583_925918596 29 Left 925918583 2:8624321-8624343 CCACCTGGGCAAAGCCAGGGCTC No data
Right 925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG No data
925918590_925918596 -8 Left 925918590 2:8624358-8624380 CCACGATGTCCTGGCCACCAAGG No data
Right 925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG No data
925918588_925918596 7 Left 925918588 2:8624343-8624365 CCGAGGCACAGGCAACCACGATG No data
Right 925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG No data
925918584_925918596 26 Left 925918584 2:8624324-8624346 CCTGGGCAAAGCCAGGGCTCCGA No data
Right 925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925918596 Original CRISPR CACCAAGGGCTGCTCTAGCA GGG Intergenic
No off target data available for this crispr