ID: 925920129

View in Genome Browser
Species Human (GRCh38)
Location 2:8632583-8632605
Sequence CTGTTTGAGCAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925920121_925920129 7 Left 925920121 2:8632553-8632575 CCACCCCAGGACAGGCAGTCACT No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920119_925920129 9 Left 925920119 2:8632551-8632573 CCCCACCCCAGGACAGGCAGTCA No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920117_925920129 11 Left 925920117 2:8632549-8632571 CCCCCCACCCCAGGACAGGCAGT No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920111_925920129 18 Left 925920111 2:8632542-8632564 CCCCCCGCCCCCCACCCCAGGAC No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920113_925920129 16 Left 925920113 2:8632544-8632566 CCCCGCCCCCCACCCCAGGACAG No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920123_925920129 3 Left 925920123 2:8632557-8632579 CCCAGGACAGGCAGTCACTGAAG No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920114_925920129 15 Left 925920114 2:8632545-8632567 CCCGCCCCCCACCCCAGGACAGG No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920116_925920129 14 Left 925920116 2:8632546-8632568 CCGCCCCCCACCCCAGGACAGGC 0: 16
1: 669
2: 3209
3: 9214
4: 7342
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920124_925920129 2 Left 925920124 2:8632558-8632580 CCAGGACAGGCAGTCACTGAAGG No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920118_925920129 10 Left 925920118 2:8632550-8632572 CCCCCACCCCAGGACAGGCAGTC No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920112_925920129 17 Left 925920112 2:8632543-8632565 CCCCCGCCCCCCACCCCAGGACA No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920120_925920129 8 Left 925920120 2:8632552-8632574 CCCACCCCAGGACAGGCAGTCAC No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data
925920122_925920129 4 Left 925920122 2:8632556-8632578 CCCCAGGACAGGCAGTCACTGAA No data
Right 925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925920129 Original CRISPR CTGTTTGAGCAGAAGGATGG AGG Intergenic
No off target data available for this crispr