ID: 925920160

View in Genome Browser
Species Human (GRCh38)
Location 2:8632751-8632773
Sequence CCCTCAGCTGGAGCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925920160_925920170 20 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920170 2:8632794-8632816 CATCCCAGGGACCCCAGTGAGGG No data
925920160_925920167 6 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920167 2:8632780-8632802 TCAGCTGGTGAGGACATCCCAGG No data
925920160_925920169 19 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920169 2:8632793-8632815 ACATCCCAGGGACCCCAGTGAGG No data
925920160_925920165 -4 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920165 2:8632770-8632792 AGGGGAATCCTCAGCTGGTGAGG No data
925920160_925920168 7 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920168 2:8632781-8632803 CAGCTGGTGAGGACATCCCAGGG No data
925920160_925920171 21 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920171 2:8632795-8632817 ATCCCAGGGACCCCAGTGAGGGG No data
925920160_925920164 -9 Left 925920160 2:8632751-8632773 CCTGGAGCAGCTCCAGCTGAGGG No data
Right 925920164 2:8632765-8632787 AGCTGAGGGGAATCCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925920160 Original CRISPR CCCTCAGCTGGAGCTGCTCC AGG (reversed) Intergenic