ID: 925922082

View in Genome Browser
Species Human (GRCh38)
Location 2:8645042-8645064
Sequence CCTCACTGGCCCGGTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925922070_925922082 16 Left 925922070 2:8645003-8645025 CCCCAGAGGCGGGCAGGGGACGA No data
Right 925922082 2:8645042-8645064 CCTCACTGGCCCGGTGCCCTGGG No data
925922071_925922082 15 Left 925922071 2:8645004-8645026 CCCAGAGGCGGGCAGGGGACGAT No data
Right 925922082 2:8645042-8645064 CCTCACTGGCCCGGTGCCCTGGG No data
925922072_925922082 14 Left 925922072 2:8645005-8645027 CCAGAGGCGGGCAGGGGACGATG No data
Right 925922082 2:8645042-8645064 CCTCACTGGCCCGGTGCCCTGGG No data
925922068_925922082 20 Left 925922068 2:8644999-8645021 CCAGCCCCAGAGGCGGGCAGGGG No data
Right 925922082 2:8645042-8645064 CCTCACTGGCCCGGTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925922082 Original CRISPR CCTCACTGGCCCGGTGCCCT GGG Intergenic
No off target data available for this crispr