ID: 925922142

View in Genome Browser
Species Human (GRCh38)
Location 2:8645309-8645331
Sequence CGGAGGGGCTGGGGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925922142_925922160 28 Left 925922142 2:8645309-8645331 CCCTCTGACCCCCAGCCCCTCCG No data
Right 925922160 2:8645360-8645382 GAGGCCCTGTGAGCACGGCGCGG No data
925922142_925922158 23 Left 925922142 2:8645309-8645331 CCCTCTGACCCCCAGCCCCTCCG No data
Right 925922158 2:8645355-8645377 TGTCCGAGGCCCTGTGAGCACGG No data
925922142_925922148 -10 Left 925922142 2:8645309-8645331 CCCTCTGACCCCCAGCCCCTCCG No data
Right 925922148 2:8645322-8645344 AGCCCCTCCGACAAGCACCGAGG No data
925922142_925922161 29 Left 925922142 2:8645309-8645331 CCCTCTGACCCCCAGCCCCTCCG No data
Right 925922161 2:8645361-8645383 AGGCCCTGTGAGCACGGCGCGGG No data
925922142_925922154 9 Left 925922142 2:8645309-8645331 CCCTCTGACCCCCAGCCCCTCCG No data
Right 925922154 2:8645341-8645363 GAGGCTCCGCCCTCTGTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925922142 Original CRISPR CGGAGGGGCTGGGGGTCAGA GGG (reversed) Intergenic
No off target data available for this crispr