ID: 925922229

View in Genome Browser
Species Human (GRCh38)
Location 2:8645588-8645610
Sequence TCCTCCCCAGGCGGGCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925922229_925922238 -3 Left 925922229 2:8645588-8645610 CCCGCCCGCCCGCCTGGGGAGGA No data
Right 925922238 2:8645608-8645630 GGAACCCAGAGGAGCCCCGTGGG No data
925922229_925922237 -4 Left 925922229 2:8645588-8645610 CCCGCCCGCCCGCCTGGGGAGGA No data
Right 925922237 2:8645607-8645629 AGGAACCCAGAGGAGCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925922229 Original CRISPR TCCTCCCCAGGCGGGCGGGC GGG (reversed) Intergenic