ID: 925931978

View in Genome Browser
Species Human (GRCh38)
Location 2:8715334-8715356
Sequence TCATAGTGTCATCTTACCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925931978_925931981 -8 Left 925931978 2:8715334-8715356 CCCAAGGTAAGATGACACTATGA No data
Right 925931981 2:8715349-8715371 CACTATGAAGACTTCTCTGGAGG No data
925931978_925931982 2 Left 925931978 2:8715334-8715356 CCCAAGGTAAGATGACACTATGA No data
Right 925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925931978 Original CRISPR TCATAGTGTCATCTTACCTT GGG (reversed) Intergenic
No off target data available for this crispr