ID: 925931978 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:8715334-8715356 |
Sequence | TCATAGTGTCATCTTACCTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925931978_925931981 | -8 | Left | 925931978 | 2:8715334-8715356 | CCCAAGGTAAGATGACACTATGA | No data | ||
Right | 925931981 | 2:8715349-8715371 | CACTATGAAGACTTCTCTGGAGG | No data | ||||
925931978_925931982 | 2 | Left | 925931978 | 2:8715334-8715356 | CCCAAGGTAAGATGACACTATGA | No data | ||
Right | 925931982 | 2:8715359-8715381 | ACTTCTCTGGAGGAGCTGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925931978 | Original CRISPR | TCATAGTGTCATCTTACCTT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |