ID: 925931979

View in Genome Browser
Species Human (GRCh38)
Location 2:8715335-8715357
Sequence TTCATAGTGTCATCTTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925931979_925931982 1 Left 925931979 2:8715335-8715357 CCAAGGTAAGATGACACTATGAA No data
Right 925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG No data
925931979_925931981 -9 Left 925931979 2:8715335-8715357 CCAAGGTAAGATGACACTATGAA No data
Right 925931981 2:8715349-8715371 CACTATGAAGACTTCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925931979 Original CRISPR TTCATAGTGTCATCTTACCT TGG (reversed) Intergenic
No off target data available for this crispr