ID: 925931982

View in Genome Browser
Species Human (GRCh38)
Location 2:8715359-8715381
Sequence ACTTCTCTGGAGGAGCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925931977_925931982 3 Left 925931977 2:8715333-8715355 CCCCAAGGTAAGATGACACTATG No data
Right 925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG No data
925931979_925931982 1 Left 925931979 2:8715335-8715357 CCAAGGTAAGATGACACTATGAA No data
Right 925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG No data
925931978_925931982 2 Left 925931978 2:8715334-8715356 CCCAAGGTAAGATGACACTATGA No data
Right 925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925931982 Original CRISPR ACTTCTCTGGAGGAGCTGTA AGG Intergenic
No off target data available for this crispr