ID: 925932699

View in Genome Browser
Species Human (GRCh38)
Location 2:8722860-8722882
Sequence TCCAGCATGGAGCAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925932699_925932704 13 Left 925932699 2:8722860-8722882 CCTGCCAACTGCTCCATGCTGGA 0: 1
1: 0
2: 2
3: 19
4: 307
Right 925932704 2:8722896-8722918 TCTTGGATTGTGGAAAGAACTGG 0: 1
1: 0
2: 3
3: 10
4: 185
925932699_925932702 -4 Left 925932699 2:8722860-8722882 CCTGCCAACTGCTCCATGCTGGA 0: 1
1: 0
2: 2
3: 19
4: 307
Right 925932702 2:8722879-8722901 TGGAAATTTATTTCGTTTCTTGG 0: 1
1: 0
2: 1
3: 34
4: 365
925932699_925932703 3 Left 925932699 2:8722860-8722882 CCTGCCAACTGCTCCATGCTGGA 0: 1
1: 0
2: 2
3: 19
4: 307
Right 925932703 2:8722886-8722908 TTATTTCGTTTCTTGGATTGTGG 0: 1
1: 0
2: 1
3: 23
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925932699 Original CRISPR TCCAGCATGGAGCAGTTGGC AGG (reversed) Intergenic
902442728 1:16441363-16441385 CACAGCCTGGAGCAGTTGGGAGG + Intronic
902862722 1:19257682-19257704 TCCAGCATGGTGCTCTGGGCTGG + Intronic
904330573 1:29755628-29755650 TCCAGGAAGGAGCAGGTGTCTGG + Intergenic
904416098 1:30361967-30361989 TCCAGGAAGGAGCAGGTGTCTGG - Intergenic
904794991 1:33051909-33051931 TCCCGGATGGGGCAGCTGGCCGG - Intronic
906259680 1:44377633-44377655 TCCAGCATGGAGAAGCCGACTGG + Intergenic
907249458 1:53128566-53128588 TGCATCATGGAGAAGTGGGCAGG + Intronic
908367448 1:63440979-63441001 ACCAGCTCGTAGCAGTTGGCAGG - Exonic
908544681 1:65150788-65150810 TCCAGGCTGGAGCAGATGGCCGG - Intronic
910815695 1:91289016-91289038 TCCCGGATGGGGCAGCTGGCCGG + Intronic
911162087 1:94691452-94691474 TCCATCAAGTGGCAGTTGGCTGG + Intergenic
911351629 1:96762414-96762436 TCCCGGATGGGGCAGCTGGCCGG + Intronic
911677039 1:100670378-100670400 TTCAGCATGGAGCAGTTTTCTGG + Intergenic
912116331 1:106412644-106412666 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
912533269 1:110341427-110341449 TCCAGAATTGAGCAGTAGCCGGG + Exonic
912604688 1:110977417-110977439 TACAGCATGGAGCCTTTTGCAGG - Intergenic
913103836 1:115594293-115594315 TCCAACATGGAGCAGGTGCTTGG - Intergenic
914231008 1:145764726-145764748 TCCTGGATGGGGCAGCTGGCCGG - Intronic
914490522 1:148148046-148148068 TCCTGCCTGTAGCAGGTGGCAGG + Intronic
917848322 1:179040556-179040578 TCCAGGACGGGGCAGCTGGCCGG + Intronic
918388642 1:184036563-184036585 TCCAGCCTGGAGCAGGAGCCCGG + Intronic
920582417 1:207123960-207123982 TCCAAGATAGAGGAGTTGGCTGG + Exonic
921638368 1:217523919-217523941 TCCCGGACGGGGCAGTTGGCCGG + Intronic
922336889 1:224625101-224625123 TCCAGCATGGGGCAGTATGGTGG + Intronic
922538697 1:226402795-226402817 GCAAGCCTGGAGCAGTTGTCTGG - Intronic
924198584 1:241637418-241637440 TACAGAATGCAGCAGTTGCCTGG + Intronic
924439308 1:244073335-244073357 TCCCGCATGGAGCTTCTGGCGGG - Intergenic
924794707 1:247284981-247285003 TCCAGCATGGTGCAGTTTGGAGG - Intergenic
1063390308 10:5646018-5646040 TCCCGCGTGGAGCTGATGGCTGG + Intronic
1063617539 10:7614236-7614258 TCAAAAATGGAGCAGTTGGCAGG + Intronic
1065434669 10:25694440-25694462 TCCAGGTTGGAGCAGAGGGCAGG + Intergenic
1065594288 10:27296384-27296406 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1066952926 10:42138348-42138370 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1067247951 10:44561825-44561847 TCCAGCCTGCAGCAGTCAGCAGG - Intergenic
1068674391 10:59755058-59755080 TTAAGAATGAAGCAGTTGGCTGG - Intergenic
1070807465 10:79279076-79279098 TCCAGGACGGGGCAGCTGGCCGG + Intronic
1075225420 10:120624596-120624618 TCCAGCATAGAGCTGTGGGGAGG + Intergenic
1075709212 10:124521694-124521716 TCCAGGCTGGGGCAGCTGGCGGG + Intronic
1076420839 10:130330556-130330578 TTCAGCACAGAGCAGCTGGCCGG - Intergenic
1077186964 11:1239727-1239749 TGCAGCATGGAGCCCCTGGCTGG + Intronic
1077254497 11:1574215-1574237 GCCAGGCTGGAGCAGGTGGCAGG + Intergenic
1077668724 11:4137916-4137938 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1077674545 11:4184641-4184663 CCCAGCCTGGAGCAGAGGGCAGG - Intergenic
1078165451 11:8879318-8879340 GCCAGCATGGATCAGTAGGGAGG - Intronic
1079039854 11:17050655-17050677 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1080042971 11:27778629-27778651 TCCAACAGGGAGCAGGTGGCTGG + Intergenic
1080608708 11:33885807-33885829 TCCAGGATGCAGTGGTTGGCTGG + Intronic
1080846334 11:36030247-36030269 TCCAGCAGGAAGCAGTTTGATGG + Intronic
1080860315 11:36145274-36145296 TCCCGGATGGGGCAGCTGGCCGG - Intronic
1082162826 11:48902165-48902187 ACCAGCATGGTGCTGCTGGCTGG - Intergenic
1082175215 11:49050143-49050165 TCCGGCATGGTGCTGCTGGCTGG - Intergenic
1082233654 11:49798225-49798247 TCCTGGATGGAGCGGCTGGCTGG + Intergenic
1083865513 11:65451289-65451311 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1084624335 11:70295577-70295599 TCCCGGATGGAGCGGCTGGCTGG + Intronic
1084770782 11:71341710-71341732 TCCAGCAAGGAGCAGGTGCACGG + Intergenic
1086690549 11:89785940-89785962 TCCGGCATGGTGCTGCTGGCTGG + Intergenic
1086715249 11:90053719-90053741 TCCGGCATGGTGCTGCTGGCTGG - Intergenic
1087214810 11:95482752-95482774 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1089810817 11:121130022-121130044 TCCAGGAAGGAGCTGTTGGAGGG - Exonic
1090457822 11:126865090-126865112 TCCAGCTTGGACCAGTTTCCTGG + Intronic
1090552691 11:127840495-127840517 TGCAGCAGGGAGCAGTGAGCAGG + Intergenic
1091709853 12:2732093-2732115 TGCAGGGTGGAGCAGTTGGTGGG - Intergenic
1092032189 12:5296220-5296242 GCCAGCATGGCCCACTTGGCAGG + Intergenic
1092401836 12:8184316-8184338 TCCTGGATGGAGCGGCTGGCCGG - Intronic
1096167277 12:49436368-49436390 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1096214107 12:49790065-49790087 CCCACCATGGAACAGTTGGTAGG + Intergenic
1096258235 12:50075482-50075504 TCCAGCCTGGAGCCTGTGGCTGG + Intronic
1096557113 12:52410086-52410108 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1097126931 12:56783461-56783483 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1097127884 12:56789276-56789298 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1097230388 12:57507502-57507524 TCCTGCATGGGGCGGCTGGCCGG + Intronic
1097910641 12:64965787-64965809 TCCAGCCTGTTGCTGTTGGCTGG + Intergenic
1100100052 12:91092126-91092148 TCCAGCCTGTTGCTGTTGGCTGG + Intergenic
1100435726 12:94569864-94569886 TCCTGCCTGCAGCAGATGGCGGG + Exonic
1103224338 12:119274179-119274201 TACAGGATGGGGCATTTGGCAGG - Intergenic
1105556006 13:21448211-21448233 TCCCGGATGGGGCAGCTGGCCGG - Intronic
1105976730 13:25480138-25480160 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1106145255 13:27044404-27044426 TGCAGCAGGGAGGAGTTGCCGGG - Intergenic
1106187823 13:27424643-27424665 TTCAGCAGGGAGCCGTGGGCCGG + Exonic
1107493173 13:40900716-40900738 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1108521700 13:51252064-51252086 TCCAGCACGGAGGAGTCGGTGGG - Exonic
1108608628 13:52064020-52064042 TCCCGGATGGGGCAGCTGGCCGG - Intronic
1108618329 13:52157676-52157698 TCCAGGATGAAGCAGCTAGCGGG + Intronic
1111463705 13:88579744-88579766 TCAAGGATGGAGGAGTTGACAGG - Intergenic
1111615631 13:90658767-90658789 TCCAGCCTGTTGCTGTTGGCTGG - Intergenic
1111990240 13:95109087-95109109 TAGAGCATGGAGCAGTTAACTGG - Intronic
1112056096 13:95691035-95691057 TCCTGGATGGAGCGGCTGGCCGG + Intronic
1113329170 13:109311775-109311797 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1113662585 13:112117584-112117606 TCCACCATGGGGCAGTGTGCCGG + Intergenic
1114427704 14:22637301-22637323 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1115493914 14:33984434-33984456 TCCTGGATGGGGCAGCTGGCCGG + Intronic
1115752582 14:36506444-36506466 TCCAGGATGGAGGAGCAGGCTGG + Intronic
1116191650 14:41673817-41673839 TCCCGGATGGGGCAGATGGCCGG + Intronic
1116301398 14:43188246-43188268 TCCAGCCTGTTGCTGTTGGCTGG - Intergenic
1117277059 14:54203446-54203468 TCCCGGACGGAGCAGCTGGCCGG - Intergenic
1117277153 14:54203643-54203665 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1118839540 14:69500469-69500491 TCCATCCTGGGGCACTTGGCAGG + Intronic
1123455499 15:20419647-20419669 TCCAGCATGGAGCATTTCTGTGG + Intergenic
1124142879 15:27092945-27092967 TCCTGCATGGTGCAGTTGAAAGG + Intronic
1124291442 15:28456452-28456474 TCCTGCCTGGAGCAGGTGACAGG - Intergenic
1130071165 15:80647718-80647740 TCCAGGATGGGGCGGCTGGCCGG - Intergenic
1132418842 15:101646742-101646764 TCCCGCACCGTGCAGTTGGCAGG + Exonic
1132600391 16:770367-770389 CCCAGGATGGGGCAGATGGCGGG + Intronic
1134053126 16:11151415-11151437 TTCAGCCTGGAGCACTGGGCAGG - Intronic
1134750106 16:16618991-16619013 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1136668633 16:31836698-31836720 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1136707340 16:32201219-32201241 TCCTGCCTGGAGCAGGTGACAGG + Intergenic
1136760573 16:32728198-32728220 TCCTGCCTGGAGCAGGTGACAGG - Intergenic
1136807530 16:33142188-33142210 TCCTGCCTGGAGCAGGTGACAGG + Intergenic
1140123435 16:72102119-72102141 TCCTGCATTGGGCAGGTGGCTGG + Intronic
1141291636 16:82723159-82723181 ACCTGCAGGGAGCAGTTGGGTGG + Intronic
1203062726 16_KI270728v1_random:988513-988535 TCCTGCCTGGAGCAGGTGACAGG - Intergenic
1144163522 17:12584746-12584768 TCCAGCAAGGAGCCATTGGCTGG - Intergenic
1144631318 17:16873904-16873926 TCCAGGATCGAGGGGTTGGCAGG + Intergenic
1145276308 17:21433238-21433260 TCCTGCATTGGGCAGGTGGCAGG - Intergenic
1145311732 17:21704607-21704629 GCCAGGATGCAGCAGCTGGCTGG + Exonic
1145314144 17:21719132-21719154 TCCTGCATTGGGCAGGTGGCAGG - Intergenic
1145684557 17:26639116-26639138 TCCCGCATGGGGCGGCTGGCCGG - Intergenic
1145712590 17:26991109-26991131 TCCTGCATTGGGCAGGTGGCAGG - Intergenic
1147132893 17:38419385-38419407 CCCAGCATGGAGCAGGTGAGCGG + Intergenic
1148330474 17:46811084-46811106 TACAGCCGGGAGGAGTTGGCAGG - Intronic
1150641410 17:66952409-66952431 TCCAGCATGGAGCAGGAGGCAGG + Intergenic
1151991479 17:77577732-77577754 TCCAACATCGAGGGGTTGGCAGG + Intergenic
1153417579 18:4865590-4865612 TACTGCATGGAGCAGTTTGAGGG + Intergenic
1153460265 18:5325261-5325283 TCCAGCCTGGTGTAGCTGGCTGG - Intergenic
1154254453 18:12770378-12770400 AGCAGCATGGAGCCTTTGGCAGG + Intergenic
1154398178 18:14010683-14010705 TCCTGGATGGGGCAGCTGGCCGG + Intergenic
1156791446 18:40979613-40979635 TCCAACATCGAGGTGTTGGCAGG + Intergenic
1157099706 18:44718296-44718318 TGCAGCATGAATCAGCTGGCAGG - Intronic
1160052021 18:75442613-75442635 TCCAGCATGGCGAAGTTTGCTGG + Intergenic
1160995092 19:1878775-1878797 TCCTGCCTGTAGCAGGTGGCAGG - Intronic
1161588452 19:5117987-5118009 GCCAGCATGGAGCACAGGGCGGG + Intronic
1161619643 19:5291329-5291351 TCCTGCATGGAGGAGGGGGCTGG + Intronic
1161790328 19:6355817-6355839 TCCCGGATGGAGCGGCTGGCCGG - Intergenic
1163140591 19:15345525-15345547 TCCAGCTTGAATGAGTTGGCTGG + Intergenic
1163195303 19:15715389-15715411 CCCAGCATGAGGCAGATGGCTGG + Intergenic
1163945424 19:20530281-20530303 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1164012099 19:21212555-21212577 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1164168057 19:22700392-22700414 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1164256603 19:23533483-23533505 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1164527508 19:29022771-29022793 TCCAGCGTGGAGCAGCAGACAGG + Intergenic
1164650159 19:29885672-29885694 TCCAGCCTGAAGCACCTGGCTGG + Intergenic
1166391260 19:42410163-42410185 TACAGAAAGGAGAAGTTGGCTGG - Intronic
1166855684 19:45781753-45781775 GCCAGCATGGGGCAGCTGCCAGG - Intronic
1167199553 19:48054937-48054959 TTCAGGATGTAGCAGCTGGCGGG + Exonic
925225774 2:2183109-2183131 AAAAGCATGGAGCAGTTGGAGGG + Intronic
925932699 2:8722860-8722882 TCCAGCATGGAGCAGTTGGCAGG - Intergenic
926480387 2:13385605-13385627 TCCAGCATGGAGCATTTCTGTGG - Intergenic
927489455 2:23511078-23511100 TCCAAGATGAAGCTGTTGGCAGG + Intronic
928596945 2:32868717-32868739 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
928631451 2:33197250-33197272 TCAAGTATGAAGTAGTTGGCCGG + Intronic
932460630 2:71879712-71879734 CCCAGCATGGGGCAGTGAGCAGG - Intergenic
934767630 2:96888894-96888916 TACAGAATGGAGTTGTTGGCGGG - Intronic
934903019 2:98176095-98176117 TTCAGCATGGAGCAGCTGCAAGG - Intronic
935284892 2:101555925-101555947 TACTGCATGGTGCAGTTGGGTGG - Intergenic
935881582 2:107571004-107571026 TCCAGGAAGGAGCAGAAGGCTGG - Intergenic
936729204 2:115360567-115360589 TCCAGGTTGGAGGAGTTGGGGGG + Intronic
940057168 2:149525561-149525583 TCCAGCCTGTTGCTGTTGGCTGG + Intergenic
942630190 2:177945748-177945770 TCCCGGATGGGGCAGCTGGCCGG - Intronic
943323561 2:186473316-186473338 TTCAGGATGGGGCAGCTGGCCGG - Intergenic
944262950 2:197696156-197696178 TCCTGGATGGGGCAGCTGGCTGG + Intronic
944866563 2:203868201-203868223 GCCAGCAGGGAGCAGTTGGGCGG + Intronic
945283285 2:208057738-208057760 TGCAGCATGGTGGAGGTGGCTGG + Intergenic
946001416 2:216485629-216485651 TCCAGCAGGGAGCAGGGGGAAGG - Intergenic
946768655 2:223064160-223064182 GCCAGCCTGGAGAAGTTGCCTGG + Intronic
948470274 2:238173090-238173112 TCCAGCATGGGGCTGAGGGCCGG + Intronic
948943588 2:241208298-241208320 TCCAGAATCAAGCTGTTGGCAGG + Intronic
948970426 2:241421443-241421465 TCCAGCCTGCTGCTGTTGGCTGG - Intronic
1169009554 20:2238775-2238797 ACCAGCATGGATCAGGAGGCTGG + Intergenic
1169180036 20:3555940-3555962 TGCAGCACGAAGCAGTTGGAAGG - Intronic
1171121353 20:22571777-22571799 CCCAGCATCGAGCAGTGGGAAGG - Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172910803 20:38407645-38407667 TCCAGGATGGGGCGGCTGGCCGG - Intergenic
1173594762 20:44251543-44251565 TGCAGCATGGACAAGTTGGAGGG - Intronic
1174218649 20:48935917-48935939 TCCCGCATGGGGCGGCTGGCCGG + Intronic
1174218703 20:48936045-48936067 TCCCGCATGGGGCGGCTGGCCGG + Intronic
1175161205 20:57009232-57009254 TACAGCAGGGAGCATTTGCCTGG + Intergenic
1178523042 21:33302356-33302378 TCCCGCATGGAGCAGTCATCGGG - Intergenic
1178812597 21:35897750-35897772 TCCCGGATGGGGCAGCTGGCCGG - Intronic
1179090465 21:38260716-38260738 TCCAGTAGGGAGCAGTTGAGTGG + Intronic
1179392604 21:41007825-41007847 TCCAGGATGGAGGTGTCGGCAGG + Intergenic
1182230785 22:28836035-28836057 TCCAGCATGGAGTTGCTGGCAGG + Intergenic
1182452764 22:30431003-30431025 TCCAGAATGGAGCAGGGAGCTGG - Intergenic
1183286269 22:36966089-36966111 TCCAGCATGGGGAAGAAGGCAGG - Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1183650155 22:39149039-39149061 TCCAGCAGGGAGTTGTTGGGAGG - Intronic
1184989954 22:48160755-48160777 TCCAAGATGGAGGTGTTGGCAGG + Intergenic
1185140438 22:49097901-49097923 TCCAGCCTGGAGCAGTGGGCTGG + Intergenic
950460909 3:13121789-13121811 CCCAGGATGGGGCAGTGGGCTGG + Intergenic
950659939 3:14460992-14461014 TCCAGCAAGGAGGAGTTGGAGGG + Intronic
950949027 3:16979986-16980008 TCCTGGATGGGGCAGCTGGCCGG + Intronic
951542803 3:23798319-23798341 TCAAGCATGGAGCAGCAGGCAGG - Intergenic
952864826 3:37847782-37847804 ACCAGCATGGGTCAGTCGGCTGG + Intergenic
953538839 3:43796527-43796549 TCCGGCAGGGAGCAGTGGGGAGG - Intergenic
954162887 3:48734657-48734679 TCCAGGATGGGGCGGCTGGCCGG - Intronic
954599868 3:51858998-51859020 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
955363014 3:58290361-58290383 TCCCGGATGGAGCGGCTGGCCGG + Intronic
955437448 3:58917161-58917183 TCCAGCATAAAGGAGTTGGCTGG + Intronic
955674477 3:61434743-61434765 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
956304379 3:67808108-67808130 TCCAGAGTGGAGAAGATGGCTGG + Intergenic
957035607 3:75289858-75289880 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
958808625 3:98837535-98837557 TCCCGGATGGGGCAGCTGGCCGG + Intronic
961316752 3:126041972-126041994 CACAGCATGGTGCAGTTGGGAGG + Intronic
962527220 3:136247646-136247668 TCCAGCTTGGGGCAGGTGGGTGG - Intergenic
965502614 3:169474304-169474326 TCTAGTATGGAGCATTAGGCTGG - Intronic
966784108 3:183608713-183608735 TCCCGGATGGGGCGGTTGGCCGG - Intergenic
967524324 3:190473595-190473617 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
968067895 3:195768982-195769004 GTCAGCACTGAGCAGTTGGCAGG - Intronic
968437252 4:600161-600183 TCCAGCCTGTTGCTGTTGGCTGG + Intergenic
968578453 4:1378750-1378772 TGCAGCAGGAAGCATTTGGCCGG + Intronic
968924137 4:3538545-3538567 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
968924161 4:3538594-3538616 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
969369759 4:6724154-6724176 GCCAGCGTGGTGCAGTTGGGAGG + Intergenic
969454540 4:7293900-7293922 TCCAGCAGGGCGCATTTGGATGG + Intronic
969711817 4:8849058-8849080 TCCACGATGGAGCAGCGGGCAGG - Intronic
970967601 4:21947066-21947088 TCAAGGCTGGAGCAGATGGCAGG - Intronic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
971594765 4:28514793-28514815 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
971620147 4:28845375-28845397 TGCAGAATGGGACAGTTGGCAGG - Intergenic
971789681 4:31153310-31153332 TCCAGCATGGAGGAATTAGGTGG + Intergenic
975522706 4:75317814-75317836 TCCTGGATGGGGCAGCTGGCTGG - Intergenic
975715580 4:77202655-77202677 TCCAGTAGGAAGCAGTTGACAGG - Intronic
975881029 4:78908127-78908149 TACAGCATGTAGCTCTTGGCTGG + Intronic
976349264 4:84042428-84042450 TCCAGGATCGAGGTGTTGGCAGG - Intergenic
978518966 4:109597605-109597627 TCCCGGATGGGGCAGCTGGCCGG + Intronic
978620735 4:110632713-110632735 TCCAGCCGGGAGGAGTAGGCTGG + Intronic
980905487 4:138944585-138944607 TCCAGCATGGAGGATTGGGGTGG - Intergenic
983527567 4:168774807-168774829 ACCAGGAGGGAGCAGGTGGCAGG - Intronic
983628769 4:169828527-169828549 TCCCGGATGGGGCAGCTGGCGGG - Intergenic
985576255 5:674778-674800 TCCAGCAGGGGACAGTGGGCTGG + Intronic
985985768 5:3515100-3515122 TCCAGCATGGCAGAGTTGCCAGG - Intergenic
986403235 5:7399071-7399093 TCCAGCATGGAAACCTTGGCAGG - Intronic
987014921 5:13808345-13808367 TCCAGGATGAAGGTGTTGGCAGG - Intronic
988239987 5:28596837-28596859 TCCTGGATGGAGCGGCTGGCCGG + Intergenic
989828954 5:45890919-45890941 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
991211540 5:64110681-64110703 TCCAGCATTCCGCAGCTGGCTGG + Intergenic
992987822 5:82251515-82251537 TCCCACATGGGACAGTTGGCTGG + Intronic
995435041 5:112126099-112126121 GGCAGCATGAAGCAGTTGGCAGG + Intergenic
996070025 5:119122409-119122431 TCCCGGATGGGGCAGCTGGCCGG + Intronic
997725789 5:136118870-136118892 ACCAGGAGAGAGCAGTTGGCAGG + Intergenic
999321041 5:150615233-150615255 GCCAGGAGGGAGGAGTTGGCAGG - Intronic
999428171 5:151505161-151505183 TCCAAAATGGAGCTGTGGGCAGG + Exonic
1001864213 5:175089184-175089206 TCCACCATGCAAGAGTTGGCAGG - Intergenic
1003483465 6:6554246-6554268 TCAAGCATGGAGAAGTTGAAAGG + Intergenic
1003936743 6:10982693-10982715 TCCAGCACTGAGCCGTGGGCCGG - Exonic
1004061004 6:12197972-12197994 TCTGGCTTGGACCAGTTGGCTGG + Intergenic
1004926959 6:20425330-20425352 TTCAGAATGGGGCAGTAGGCTGG + Intronic
1006886687 6:37387931-37387953 TTCAGCCTGGAAAAGTTGGCAGG + Intronic
1007730604 6:43943240-43943262 TCCTGCATGCAGCAGTTTGGGGG - Intergenic
1009913715 6:69966167-69966189 TCCCGCACGGGGCAGCTGGCCGG - Intronic
1010030454 6:71266535-71266557 TCCCGGATGGAGCGGCTGGCTGG + Intergenic
1010245783 6:73660441-73660463 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1010245883 6:73660666-73660688 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1011297347 6:85838981-85839003 TCCCGGACGGAGCAGCTGGCCGG - Intergenic
1012289792 6:97438686-97438708 TCCAGAATGAAGGACTTGGCAGG + Intergenic
1015098925 6:129451372-129451394 TCCTGCACCCAGCAGTTGGCAGG + Intronic
1017149336 6:151264050-151264072 TCCAGCTTGGGGCAGGTGGAGGG + Intronic
1017717777 6:157224336-157224358 TCCAGCAGCGAGGAGGTGGCTGG + Intergenic
1019538416 7:1540595-1540617 TCCTGCGGGGAGCAGGTGGCGGG - Exonic
1021440478 7:20669122-20669144 TCCCGGATGGGGCAGCTGGCCGG - Intronic
1022296681 7:29062201-29062223 ACCAGCCTGGAGCAGATGTCAGG - Intronic
1027371112 7:77509301-77509323 TCCCGGATGGGGCAGCTGGCCGG - Intergenic
1027809946 7:82883707-82883729 TCATGCCTGGAGCAATTGGCTGG - Intronic
1029580252 7:101432461-101432483 TCCTGGCTTGAGCAGTTGGCTGG + Intronic
1030830248 7:114211077-114211099 TCCAGCTTGCTGCTGTTGGCTGG + Intronic
1031012195 7:116536219-116536241 TCCATAATGGAGCAAGTGGCAGG - Intronic
1031461788 7:122060222-122060244 TCCAGCCTAGACCAGTTGGCAGG + Intronic
1035130290 7:156646284-156646306 TCCAAAATGGCGCTGTTGGCAGG + Intronic
1035522590 8:287160-287182 TCCAGCATGGAGCAGGCACCAGG - Intergenic
1036686839 8:10917374-10917396 TCCACCATGCAGCACTTGGCAGG - Intronic
1037302462 8:17467172-17467194 TCAAGGCTGAAGCAGTTGGCAGG - Intergenic
1037890743 8:22622643-22622665 TCCAGGTTGGAGCAGATGGGAGG - Intronic
1037917770 8:22783038-22783060 TTCTGCATGGAGCAGGTGCCTGG - Intronic
1038021535 8:23555368-23555390 TCCAACCTGGAGAAGGTGGCTGG - Intronic
1039048503 8:33472276-33472298 TGCAGCAGGGAGCAGGGGGCAGG + Intronic
1039390890 8:37180022-37180044 TCCTGCATGGAGCTGTGAGCTGG - Intergenic
1040043393 8:42939414-42939436 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1040093233 8:43419397-43419419 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1041571203 8:59338477-59338499 TCCAGCATGCAGCACATGGAAGG - Intergenic
1041650518 8:60297836-60297858 TCCAGGCTGGAGCAGTTCCCAGG - Intergenic
1042303715 8:67311308-67311330 TCCTGGATGGGGCAGCTGGCCGG - Intronic
1042319698 8:67461709-67461731 TCCCGGATGGAGCGGCTGGCCGG + Intronic
1043890157 8:85644867-85644889 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043891769 8:85657057-85657079 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043892839 8:85663894-85663916 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043895403 8:85734895-85734917 TCCAGCATGCAGCAGACTGCTGG + Intergenic
1043897273 8:85746913-85746935 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043899600 8:85765281-85765303 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043901207 8:85777474-85777496 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043903171 8:85792749-85792771 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043904782 8:85804942-85804964 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1043906394 8:85817133-85817155 TCCAGCATGCAGCAGACTGCTGG - Intergenic
1044447613 8:92297078-92297100 TCCAGCCTGCTGCTGTTGGCTGG + Intergenic
1045298575 8:100892422-100892444 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1047665057 8:127082422-127082444 TCCAGGATCAAGCTGTTGGCTGG - Intergenic
1048718774 8:137298717-137298739 TCCAGCATGTGGCATTTAGCAGG + Intergenic
1049363603 8:142225863-142225885 TCTGGGATGGAGGAGTTGGCAGG + Intronic
1049729470 8:144168518-144168540 TCCAGCCAGGAGCAGTGGGTCGG + Intronic
1050075421 9:1857819-1857841 TGCATCATGGTGCAGTAGGCTGG - Intergenic
1051069897 9:13152999-13153021 TGCAGCATGGAGCAGATTGCAGG - Intronic
1051258152 9:15234376-15234398 TCCTGGATGGGGCAGCTGGCCGG - Intronic
1052743533 9:32416684-32416706 TTCAGCATGTAGCATGTGGCAGG + Intronic
1055016405 9:71623395-71623417 TCCAAGATGGAGGTGTTGGCAGG + Intergenic
1056022542 9:82455586-82455608 TCCACCCTGGAGCAGTGAGCAGG - Intergenic
1056036597 9:82612799-82612821 TCCAAAATGTAGCAGCTGGCGGG + Intergenic
1057211123 9:93201645-93201667 TCCAGCATGTAGCCCTGGGCAGG - Intronic
1057751556 9:97796765-97796787 TCCCGCATGGGGCGGCTGGCCGG - Intergenic
1058018915 9:100068097-100068119 TCCTGGATGGGGCAGCTGGCCGG - Intronic
1059244338 9:112836893-112836915 TCCTGCATGGGGGAGTTGCCAGG + Intronic
1059510008 9:114836293-114836315 TCCAGCCTGTTGCTGTTGGCTGG + Intergenic
1059879850 9:118678031-118678053 TCCTGGATGGGGCAGCTGGCCGG + Intergenic
1061143357 9:128781683-128781705 TTCAGCAGGAAGCAGGTGGCAGG - Intergenic
1062519552 9:136952003-136952025 CCCAGCATGGGGCACTTGGAAGG + Intronic
1203405805 Un_KI270539v1:872-894 TCCCGCATGGGGCGGCTGGCCGG - Intergenic
1185924055 X:4127174-4127196 TCCAAGATGGAGCTGTTGGCAGG + Intergenic
1187938673 X:24361095-24361117 CCCAGCATGGACCAGTTGTCTGG + Intergenic
1188367443 X:29333247-29333269 TCCCGGATGGGGCAGCTGGCCGG + Intronic
1189458019 X:41211730-41211752 TCCCGGATGGGGCAGCTGGCTGG - Intronic
1189819887 X:44859853-44859875 TCAAGAATGGAGAAGTCGGCTGG - Intergenic
1190505221 X:51119568-51119590 TCCCGGATGGGGCAGCTGGCCGG + Intergenic
1192897468 X:75459367-75459389 TTCAGCCTGTTGCAGTTGGCTGG - Intronic
1194134034 X:90116614-90116636 TCCATCATGAAGTATTTGGCTGG + Intergenic
1194545933 X:95233664-95233686 TCCAGCTTGTGGCAGTGGGCAGG - Intergenic
1194754324 X:97719817-97719839 TACAAAATGGGGCAGTTGGCTGG + Intergenic
1195862751 X:109398992-109399014 GCCTGCAAGTAGCAGTTGGCAGG + Intronic
1198147755 X:133874636-133874658 CCCAGCATGCAGCAGGTTGCAGG + Intronic
1200094105 X:153649300-153649322 TCCAGCATGGCGCCGGTGCCCGG + Exonic
1200455252 Y:3382912-3382934 TCCAGCATGGAGGTTTTGGGTGG - Intergenic
1200479813 Y:3686729-3686751 TCCATCATGAAGTATTTGGCTGG + Intergenic