ID: 925938660

View in Genome Browser
Species Human (GRCh38)
Location 2:8793401-8793423
Sequence TGGGAGCATCGCTTAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114029
Summary {0: 3, 1: 275, 2: 5422, 3: 32847, 4: 75482}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925938654_925938660 8 Left 925938654 2:8793370-8793392 CCTGTAGTTCCAAGTACTCAGGA 0: 3
1: 159
2: 4424
3: 59438
4: 184164
Right 925938660 2:8793401-8793423 TGGGAGCATCGCTTAAGCCCAGG 0: 3
1: 275
2: 5422
3: 32847
4: 75482
925938657_925938660 -1 Left 925938657 2:8793379-8793401 CCAAGTACTCAGGAGGCTGAGGT 0: 34
1: 1135
2: 19884
3: 129084
4: 233369
Right 925938660 2:8793401-8793423 TGGGAGCATCGCTTAAGCCCAGG 0: 3
1: 275
2: 5422
3: 32847
4: 75482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925938660 Original CRISPR TGGGAGCATCGCTTAAGCCC AGG Intronic
Too many off-targets to display for this crispr