ID: 925940271

View in Genome Browser
Species Human (GRCh38)
Location 2:8810311-8810333
Sequence CTGTGCTAAGTGCAGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925940267_925940271 24 Left 925940267 2:8810264-8810286 CCCTGCTTCTCTAAACAGAGATC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 179
925940268_925940271 23 Left 925940268 2:8810265-8810287 CCTGCTTCTCTAAACAGAGATCA 0: 1
1: 0
2: 0
3: 9
4: 179
Right 925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG 0: 1
1: 0
2: 1
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925940271 Original CRISPR CTGTGCTAAGTGCAGGTACA GGG Intronic
900936942 1:5772068-5772090 CTGTTCTAAGTGTTGGCACATGG - Intergenic
901604948 1:10451804-10451826 CTGTGCTGAGTGCGGGCACTGGG + Exonic
907317729 1:53583241-53583263 CTGTGCTCAGGGAAGGCACAGGG - Intronic
908356471 1:63328600-63328622 CTGTTCTAAGCACTGGTACACGG + Intergenic
911840877 1:102680263-102680285 CAGTGCTAAGGGCAGATGCATGG + Intergenic
919422692 1:197390321-197390343 CTGTGCTCAGAGGAGGTAAATGG + Intronic
919685973 1:200483968-200483990 CAGTGCTAAGGGCAGGTTGATGG - Intergenic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
920891392 1:209989966-209989988 TTGTGCTAACTGCAAGTACATGG - Intronic
921595317 1:217048205-217048227 GTGTGCTCAGTGGAGGGACAAGG + Intronic
923600627 1:235399617-235399639 GTGTGCTAAGGCGAGGTACAGGG - Intronic
1062763577 10:45508-45530 CTGTTCTAAGAGCAGGAAAAGGG - Intergenic
1064276959 10:13915318-13915340 ATGTGTTAAGTGCTGGTGCATGG + Intronic
1065513338 10:26501442-26501464 CTGAGCTAAGAACAGGGACATGG - Intronic
1067687386 10:48475221-48475243 CTGAGCCAAGTGAAGGAACAAGG - Intronic
1068208069 10:53883471-53883493 CTGTGCTAAGGGCTGATACTCGG + Intronic
1070197942 10:74176407-74176429 CTTTCCTAAGTGCTGTTACAGGG + Intronic
1070440644 10:76439765-76439787 CTGTGCTAAATGCAGGCGTATGG + Intronic
1070855171 10:79602977-79602999 CTGTCCTTAGTGCCTGTACATGG + Intergenic
1071437349 10:85659782-85659804 CTGTGCCATGTGCTGTTACATGG + Intronic
1072301795 10:94068957-94068979 CTGTGCTAAGCACAGGGGCAGGG - Intronic
1072805896 10:98423956-98423978 CTGTCCTGGGTGCAGGAACAAGG - Intronic
1076659419 10:132045418-132045440 CTGTGCCAGGTGCGGGTAGAGGG - Intergenic
1078456603 11:11480730-11480752 CTGTGAGAAGTGCTGATACAGGG - Intronic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1079903682 11:26220127-26220149 CTCAGCTAAGTGGAGGTACCTGG - Intergenic
1083893421 11:65608172-65608194 CTGGGCCAAGTCCAGGGACAGGG - Intronic
1085961778 11:81469981-81470003 GGGTGCTCAGTCCAGGTACAAGG + Intergenic
1088133408 11:106523870-106523892 TTCTGCTATGTACAGGTACAGGG + Intergenic
1090081546 11:123616785-123616807 CTGTGCTAAGTGAAGGTCAAGGG - Intronic
1090236060 11:125148140-125148162 CTGCACTAAGTTCAGGTTCATGG - Intergenic
1091804128 12:3343780-3343802 ATGTGCTATGTGCTGGTACTTGG + Intergenic
1093632835 12:21430740-21430762 CTGTGCTAAGTGCTGGGATTAGG + Intergenic
1094445690 12:30527260-30527282 CTGTGCTAAGTCCTGGTAAGAGG - Intergenic
1095672829 12:44879867-44879889 CTTTGCCACTTGCAGGTACAAGG + Intronic
1095950030 12:47776745-47776767 CTTTGGTATGTGCATGTACATGG + Intronic
1098520224 12:71427255-71427277 CTTTGCAGAGTACAGGTACAGGG - Intronic
1100990238 12:100244034-100244056 CTGTGCTAAGTAAAGGTTCAAGG - Intronic
1106255579 13:28019607-28019629 GTGGGCAAAGTGCAGGTAGATGG - Intronic
1106869554 13:34003927-34003949 CTGTGATGAGTGCAGGGAAATGG - Intergenic
1107982543 13:45747372-45747394 CAGTGCTTAGTCCAGGTAAAGGG + Intergenic
1108047162 13:46394163-46394185 CTATGCCCAGTGTAGGTACAGGG + Intronic
1111686812 13:91512527-91512549 CTTTGCCAAGTGCAGGGACATGG - Intronic
1112318491 13:98386083-98386105 GTGTTCTAAGTGTAGGTCCATGG - Intronic
1112474843 13:99722031-99722053 CTGTGCTAAGAGCAAATGCAGGG - Intronic
1115912915 14:38276466-38276488 CTGTTCTAAGTGCAGAAACAGGG + Intergenic
1116610155 14:47058861-47058883 CTGTTCTAAGTGTGGCTACACGG - Intronic
1119621073 14:76132287-76132309 CTGTGCTAAGTGCTGTGCCAAGG + Intergenic
1121349263 14:93160610-93160632 CTCTGCTCAGAACAGGTACAAGG - Intergenic
1121585155 14:95058314-95058336 GTGTGCTAAGTGCTGGGACCTGG + Intergenic
1121845430 14:97168384-97168406 CTCTGCTAGGTGCTGGGACATGG - Intergenic
1124345846 15:28920923-28920945 CTGTGCGAAGTCCAGGCAGATGG + Intronic
1126328578 15:47507942-47507964 TTGGCCTAATTGCAGGTACAGGG - Intronic
1128248112 15:66146876-66146898 ATGGGCAAAGAGCAGGTACAAGG - Intronic
1135251624 16:20905224-20905246 CAGTGCTAAGTGATGTTACATGG + Intronic
1135636120 16:24077097-24077119 CTGTGCTCAGTACTGGAACAGGG - Intronic
1137283292 16:46996058-46996080 ATCTGCTAAGTGCAGGTAGTTGG + Intergenic
1138349650 16:56339686-56339708 CGGTGCTGAGAGCAGGTACGAGG - Intronic
1138451531 16:57096007-57096029 CTGTTCTAAGTGCTGGGACATGG - Intronic
1140041649 16:71412294-71412316 CTGTGCCAGGTGCAGGGTCAAGG - Intergenic
1142067126 16:88069011-88069033 CTGGGCTGGGTGCAGGGACAGGG - Intronic
1151499880 17:74481829-74481851 CTGTGGTAAGTGCAGGAGCCCGG + Exonic
1152232327 17:79120222-79120244 CTGTGCTGAGTGCAGGGATATGG - Intronic
1152956486 18:45839-45861 CTGTTCTAAGAGCAGGAAAAGGG - Intergenic
1153650654 18:7237039-7237061 CTGAGCTGAGAGCAGGCACATGG + Intergenic
1157160818 18:45312885-45312907 ATGTGCTGACTGCAGGTGCAGGG + Intronic
1157480994 18:48053804-48053826 GAGTGCTAAGTGCTGGTTCATGG + Intronic
1157602864 18:48904972-48904994 TTTTGCTAAGTGCAAGTCCAGGG + Intergenic
1161979034 19:7621014-7621036 CTGTGCGTACAGCAGGTACAAGG + Exonic
1164427770 19:28157683-28157705 CTTTTCTCAGTGCAGGTGCATGG - Intergenic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925098498 2:1226509-1226531 CTCTGCTAAATGGAGGTGCAAGG + Intronic
925191509 2:1888173-1888195 CTTTCCTAAGTGTAGATACATGG + Intronic
925620807 2:5790972-5790994 CTGTGCTAATTGCAGGGCCATGG + Intergenic
925940271 2:8810311-8810333 CTGTGCTAAGTGCAGGTACAGGG + Intronic
926428302 2:12759968-12759990 CTGTGCTAGGTGCAAGAATATGG + Intergenic
926900643 2:17748017-17748039 TTTTGCAAAGTGCAGCTACAGGG + Intronic
927966560 2:27273661-27273683 CTGTGGTCAGTGCAGGGAGAGGG - Intronic
937705196 2:124912389-124912411 CTGTGCTAAGTAGAGGAATATGG + Intronic
939257783 2:139766689-139766711 TTGTGCTCAGTGCAGGCAGAAGG + Intergenic
941482534 2:166034836-166034858 CTGTCCTCAATGCATGTACATGG - Intronic
945180715 2:207088366-207088388 CTGTGATAAGTCCAAGCACACGG + Intronic
947758818 2:232588475-232588497 CTGTGCTAAGTTGAGGAGCAGGG - Intergenic
948032717 2:234832565-234832587 CTGTGCTAAATACTGGCACATGG + Intergenic
1169537034 20:6556403-6556425 CTGTTATAAGTGCTGTTACATGG + Intergenic
1171251854 20:23654876-23654898 GTGTGCCAAGTGCAGAAACAGGG + Intergenic
1172303212 20:33864030-33864052 CAGTGCAAAGTGAAGATACAGGG + Intergenic
1172675307 20:36665970-36665992 CTGTGCTAAACTCAGTTACAAGG - Intronic
1172698937 20:36840897-36840919 CTGTGCTAAGCGCAGGGGCAGGG + Intronic
1173192421 20:40886715-40886737 CACTGGTAAGTGGAGGTACATGG + Intergenic
1174309581 20:49641229-49641251 CTCTTCTAAATGCTGGTACACGG - Intronic
1176069949 20:63221006-63221028 CACTGCCGAGTGCAGGTACAGGG + Intergenic
1179201243 21:39223614-39223636 ATGAGCTAAGTGTAGGTACCAGG + Intronic
1181528883 22:23504815-23504837 CTGTGCTGTGTGCAGGGCCAGGG + Intergenic
1181813024 22:25415872-25415894 GTGTGCTAAGTGCAGATGCTGGG + Intergenic
1182253252 22:29018792-29018814 CTGTGCTAAATGAATGCACAGGG - Intronic
951550807 3:23873353-23873375 CTGTACTGAGGGAAGGTACAGGG + Intronic
954108305 3:48420766-48420788 CTGTGCTCTGTGCAGGTGCCAGG - Exonic
955793912 3:62615450-62615472 CTGTGTTAAGTGCTTTTACATGG + Intronic
955889006 3:63630921-63630943 ATGTTCTAAGTGCATATACAAGG - Intergenic
956345919 3:68278670-68278692 CTGTGCTAAGAAAAGGTGCAAGG - Intronic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
962425655 3:135267039-135267061 TTGTACTAAGTTCAGGTATAAGG - Intergenic
964982673 3:162704978-162705000 CTGTCCTAGGACCAGGTACAAGG - Intergenic
965875485 3:173313226-173313248 GCCTGCTAAGTGCAGGCACATGG - Intergenic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968357845 3:198122391-198122413 CTGTTCTAAGAGCAGGAAAAGGG + Intergenic
968551802 4:1227310-1227332 GTGTGCTGAGTGCATGTGCACGG + Intronic
968551811 4:1227477-1227499 GTGTGCTGAGTGCATGTGCACGG + Intronic
968551816 4:1227587-1227609 GTGTGCTGAGTGCATGTGCACGG + Intronic
968551819 4:1227633-1227655 GTGTGCTAACTGCATGTGCATGG + Intronic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
969277339 4:6145411-6145433 GTGAGCTCAGTGCAGGGACAAGG - Intronic
969478987 4:7437096-7437118 CTGTGCTAACTCCAGGTAGTTGG - Intronic
969521422 4:7679983-7680005 CTGTCCTCAGGGCAGGTAGAAGG - Intronic
970286658 4:14524633-14524655 CAGTTCTCAGTGCAGGAACAAGG + Intergenic
975721394 4:77251918-77251940 CTGTGCCAAGTGCTTCTACATGG - Intronic
975724621 4:77279902-77279924 CTGTGCCAAGTGCTTCTACATGG - Intronic
976588052 4:86820664-86820686 CTGTGCTATGTTCAGGCACATGG - Intergenic
977796311 4:101169283-101169305 CTGTGCTAAATCCATGTAGAAGG - Intronic
979469181 4:121073964-121073986 CTATAATAAGTGCAGGTACCTGG + Intergenic
980210519 4:129781661-129781683 CTGTACAAAGTCCAGGTAGATGG - Intergenic
985085241 4:186306429-186306451 CTGTGTTAAGTGCAGGGAGTAGG - Intergenic
985704607 5:1393092-1393114 CTGTGCTAACTGCAGCTGCCTGG + Exonic
985929944 5:3049391-3049413 CTGTGCTAACTGCAGGAAAGGGG + Intergenic
993598042 5:89884237-89884259 CTGTGGTAAGAGCATGTACCTGG + Intergenic
997895780 5:137715614-137715636 CTGTGCTAGGTTCAGGAACATGG - Intronic
999309915 5:150545297-150545319 CTGGGCTTCCTGCAGGTACATGG + Exonic
1001585110 5:172828543-172828565 TTGTGATAAGTGCAGTGACAAGG - Intergenic
1001963290 5:175893625-175893647 CTGTGCTTAGTGCTGATCCAGGG - Intergenic
1003238319 6:4318410-4318432 CTGTGCTAATCCCAGGTAGATGG + Intergenic
1003336089 6:5173985-5174007 CTGGGGTAAATGCAGGTCCAAGG + Intronic
1003447469 6:6197856-6197878 CTCTGCTAAGAGCAGCTTCAAGG + Intronic
1003537242 6:6985983-6986005 ATGTTCTAAGTGCAGGAACCAGG + Intergenic
1004326029 6:14674703-14674725 CTGTGCTAAGTTCAGTCACCAGG - Intergenic
1005433524 6:25783504-25783526 TTTTGCTAGGTCCAGGTACATGG + Intronic
1005468936 6:26142854-26142876 CTTTGCTAAGTGCAAGTACAGGG + Intergenic
1007545535 6:42690842-42690864 CTTTGCCAAGAGCAGGTAAAAGG - Intronic
1010368901 6:75084910-75084932 CTGTGCTAACTAAAGGCACACGG + Exonic
1010931828 6:81813018-81813040 CTGTGTAAAGTGCAGTCACATGG - Intergenic
1012068590 6:94581393-94581415 CTGTGCACAGTACAGGGACAGGG + Intergenic
1017248086 6:152249388-152249410 CTGTGCTATGGGAAGGTAAAAGG + Intronic
1020064872 7:5180389-5180411 GTGGGCTACGTGCATGTACAGGG - Intergenic
1020483684 7:8694229-8694251 CTTTCCTAAGTGCAGGTGCGTGG + Intronic
1022712195 7:32862519-32862541 GTGCGATAAGTGCAGGGACATGG + Intergenic
1022911684 7:34904864-34904886 GTGTGATAAGTGCAGGGACATGG - Intergenic
1024240743 7:47433677-47433699 CTGTGGAAAGTGCAGGTTCTAGG - Intronic
1024391927 7:48823970-48823992 CTGTACTAAATGCAGTTAAATGG - Intergenic
1024507200 7:50171944-50171966 CTTTGAGAACTGCAGGTACAGGG + Intergenic
1026127711 7:67594180-67594202 CTGTGCTGATTGCAGGAATATGG + Intergenic
1026579640 7:71603861-71603883 CTGTGCTAAGTGCATACACCAGG + Intronic
1026579643 7:71603911-71603933 CTATGCTAAGTGCATTTACCAGG + Intronic
1026579650 7:71604011-71604033 CTATGCTAAGTGCACATACCAGG + Intronic
1026579655 7:71604061-71604083 CTATGCTAAGTGCATATACCAGG + Intronic
1026579675 7:71604410-71604432 CTATGCTAAGTGCATGCACTAGG + Intronic
1029938142 7:104450409-104450431 CTTTGTTCAGTGCAGGGACATGG + Intronic
1030343491 7:108407515-108407537 CTGTGCTCTGAGCAGGTACTTGG - Intronic
1031274088 7:119696048-119696070 CTTTGCTCTGTGCATGTACAGGG - Intergenic
1032663989 7:134016655-134016677 CTGGCCTTAGTGAAGGTACAAGG - Intronic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1034864624 7:154630477-154630499 CTGTGGAAAGACCAGGTACATGG + Intronic
1036009799 8:4709273-4709295 CTTGGCTAACTGCAGGTAGAAGG + Intronic
1039778533 8:40760804-40760826 CTGTGCAACTTGCAGGTGCATGG - Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1043410702 8:79991011-79991033 CTGTGGCAAATTCAGGTACAAGG + Intronic
1045413057 8:101938773-101938795 CTGTGCTCAGTACAGGTTGAGGG - Intronic
1045752227 8:105498597-105498619 CTGTGCTAAGAGCAGATGCTTGG - Intronic
1046645842 8:116784418-116784440 TTGTGATAGGAGCAGGTACAGGG + Intronic
1048565094 8:135588059-135588081 CTGTGCTAACTCCTGGTAAATGG - Intronic
1048705738 8:137151109-137151131 CTGTGCTAAGGGCAGTGAAATGG - Intergenic
1048900152 8:139029378-139029400 ATGTGATACGTGCAGGTAGAAGG - Intergenic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1050823571 9:9914459-9914481 GTCTGCTAAGTGCAGGCACAGGG - Intronic
1051376988 9:16412106-16412128 CTTTGGTAAGTACAAGTACAGGG - Exonic
1054779527 9:69153769-69153791 CAGTTCATAGTGCAGGTACAGGG - Intronic
1056631090 9:88293705-88293727 CTGTGCTATCTCCAGGTAGATGG - Intergenic
1057700397 9:97359898-97359920 CTGTGGGAAGTGCGGGAACAGGG - Intronic
1058668193 9:107339341-107339363 CTGTGCTAAGTGCTCGTATGAGG + Intergenic
1059657809 9:116372083-116372105 CTTTGAAAAGTGCATGTACAGGG - Intronic
1059925163 9:119202309-119202331 ATGGGCTAAGTTCAGGTTCATGG - Intronic
1187556973 X:20361467-20361489 CTGCGGTAAGTGCAGCTACCGGG - Intergenic
1187762546 X:22603561-22603583 CTGTGCCAAGTGAAGGGATAGGG + Intergenic
1188445533 X:30249845-30249867 CAGAGCTAAGTGCAGAGACAGGG - Intronic
1189090643 X:38079007-38079029 CTGTGATAAATGCACGTTCAAGG - Intronic
1189153155 X:38728062-38728084 ATGTGATATGTGTAGGTACATGG + Intergenic
1189285925 X:39852469-39852491 CTGTGCTAAGTGCTGGCATTAGG - Intergenic
1189518473 X:41740703-41740725 CTGTGATTAGTACAGGAACAAGG - Intronic
1189574097 X:42331651-42331673 CTTTGCTAAGTGCAAAAACAAGG + Intergenic
1189609144 X:42713622-42713644 CTGTGGTAAGAGTAGGTTCAGGG + Intergenic
1190501028 X:51078591-51078613 CTCTGCCATGTGGAGGTACAAGG + Intergenic
1190816735 X:53936278-53936300 CTGTGCTTAGGGCCAGTACATGG - Intergenic
1191888864 X:65920170-65920192 CTGTGCTCTGGGCTGGTACAGGG + Intergenic
1196868024 X:120086910-120086932 ATGTGCAAAGTGCAGGAAAATGG - Intergenic
1197530458 X:127617398-127617420 CTGTCATAAATGCAGATACATGG + Intergenic
1198420711 X:136468837-136468859 ATGTGCCAAGTGCAGGTACTGGG - Intergenic