ID: 925943699

View in Genome Browser
Species Human (GRCh38)
Location 2:8841848-8841870
Sequence CTGGCTTTCACCTGAGTTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925943694_925943699 17 Left 925943694 2:8841808-8841830 CCTCGCTGACAACTTCTGATGAA No data
Right 925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG No data
925943696_925943699 -7 Left 925943696 2:8841832-8841854 CCGTCCATGCTCCTTGCTGGCTT No data
Right 925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG No data
925943693_925943699 24 Left 925943693 2:8841801-8841823 CCATGCTCCTCGCTGACAACTTC No data
Right 925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG No data
925943692_925943699 28 Left 925943692 2:8841797-8841819 CCGTCCATGCTCCTCGCTGACAA No data
Right 925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925943699 Original CRISPR CTGGCTTTCACCTGAGTTGC CGG Intergenic
No off target data available for this crispr