ID: 925947068 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:8875037-8875059 |
Sequence | GAAACAAGGACCAAAATAAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 394 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 376} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925947068_925947073 | 15 | Left | 925947068 | 2:8875037-8875059 | CCTGTTATTTTGGTCCTTGTTTC | 0: 1 1: 0 2: 1 3: 16 4: 376 |
||
Right | 925947073 | 2:8875075-8875097 | ATCCTAACTGATGCAGATAGAGG | 0: 1 1: 0 2: 0 3: 5 4: 106 |
||||
925947068_925947075 | 27 | Left | 925947068 | 2:8875037-8875059 | CCTGTTATTTTGGTCCTTGTTTC | 0: 1 1: 0 2: 1 3: 16 4: 376 |
||
Right | 925947075 | 2:8875087-8875109 | GCAGATAGAGGAGAGAACAGTGG | 0: 1 1: 0 2: 3 3: 43 4: 609 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925947068 | Original CRISPR | GAAACAAGGACCAAAATAAC AGG (reversed) | Intronic | ||