ID: 925947068 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:8875037-8875059 |
| Sequence | GAAACAAGGACCAAAATAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 394 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 376} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 925947068_925947075 | 27 | Left | 925947068 | 2:8875037-8875059 | CCTGTTATTTTGGTCCTTGTTTC | 0: 1 1: 0 2: 1 3: 16 4: 376 |
||
| Right | 925947075 | 2:8875087-8875109 | GCAGATAGAGGAGAGAACAGTGG | 0: 1 1: 0 2: 3 3: 43 4: 609 |
||||
| 925947068_925947073 | 15 | Left | 925947068 | 2:8875037-8875059 | CCTGTTATTTTGGTCCTTGTTTC | 0: 1 1: 0 2: 1 3: 16 4: 376 |
||
| Right | 925947073 | 2:8875075-8875097 | ATCCTAACTGATGCAGATAGAGG | 0: 1 1: 0 2: 0 3: 5 4: 106 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 925947068 | Original CRISPR | GAAACAAGGACCAAAATAAC AGG (reversed) | Intronic | ||