ID: 925947068

View in Genome Browser
Species Human (GRCh38)
Location 2:8875037-8875059
Sequence GAAACAAGGACCAAAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925947068_925947073 15 Left 925947068 2:8875037-8875059 CCTGTTATTTTGGTCCTTGTTTC 0: 1
1: 0
2: 1
3: 16
4: 376
Right 925947073 2:8875075-8875097 ATCCTAACTGATGCAGATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 106
925947068_925947075 27 Left 925947068 2:8875037-8875059 CCTGTTATTTTGGTCCTTGTTTC 0: 1
1: 0
2: 1
3: 16
4: 376
Right 925947075 2:8875087-8875109 GCAGATAGAGGAGAGAACAGTGG 0: 1
1: 0
2: 3
3: 43
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925947068 Original CRISPR GAAACAAGGACCAAAATAAC AGG (reversed) Intronic