ID: 925947073

View in Genome Browser
Species Human (GRCh38)
Location 2:8875075-8875097
Sequence ATCCTAACTGATGCAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925947069_925947073 1 Left 925947069 2:8875051-8875073 CCTTGTTTCAGCAGCCAAACCCA 0: 1
1: 0
2: 0
3: 16
4: 205
Right 925947073 2:8875075-8875097 ATCCTAACTGATGCAGATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 106
925947068_925947073 15 Left 925947068 2:8875037-8875059 CCTGTTATTTTGGTCCTTGTTTC 0: 1
1: 0
2: 1
3: 16
4: 376
Right 925947073 2:8875075-8875097 ATCCTAACTGATGCAGATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 106
925947066_925947073 28 Left 925947066 2:8875024-8875046 CCTTGTTTAAGTTCCTGTTATTT 0: 1
1: 0
2: 3
3: 36
4: 458
Right 925947073 2:8875075-8875097 ATCCTAACTGATGCAGATAGAGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925947073 Original CRISPR ATCCTAACTGATGCAGATAG AGG Intronic