ID: 925947075

View in Genome Browser
Species Human (GRCh38)
Location 2:8875087-8875109
Sequence GCAGATAGAGGAGAGAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 609}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925947069_925947075 13 Left 925947069 2:8875051-8875073 CCTTGTTTCAGCAGCCAAACCCA 0: 1
1: 0
2: 0
3: 16
4: 205
Right 925947075 2:8875087-8875109 GCAGATAGAGGAGAGAACAGTGG 0: 1
1: 0
2: 3
3: 43
4: 609
925947071_925947075 -6 Left 925947071 2:8875070-8875092 CCCATATCCTAACTGATGCAGAT 0: 1
1: 0
2: 1
3: 13
4: 102
Right 925947075 2:8875087-8875109 GCAGATAGAGGAGAGAACAGTGG 0: 1
1: 0
2: 3
3: 43
4: 609
925947072_925947075 -7 Left 925947072 2:8875071-8875093 CCATATCCTAACTGATGCAGATA 0: 1
1: 0
2: 1
3: 5
4: 134
Right 925947075 2:8875087-8875109 GCAGATAGAGGAGAGAACAGTGG 0: 1
1: 0
2: 3
3: 43
4: 609
925947070_925947075 -1 Left 925947070 2:8875065-8875087 CCAAACCCATATCCTAACTGATG 0: 1
1: 0
2: 2
3: 13
4: 120
Right 925947075 2:8875087-8875109 GCAGATAGAGGAGAGAACAGTGG 0: 1
1: 0
2: 3
3: 43
4: 609
925947068_925947075 27 Left 925947068 2:8875037-8875059 CCTGTTATTTTGGTCCTTGTTTC 0: 1
1: 0
2: 1
3: 16
4: 376
Right 925947075 2:8875087-8875109 GCAGATAGAGGAGAGAACAGTGG 0: 1
1: 0
2: 3
3: 43
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925947075 Original CRISPR GCAGATAGAGGAGAGAACAG TGG Intronic