ID: 925947263

View in Genome Browser
Species Human (GRCh38)
Location 2:8877235-8877257
Sequence AAGCTTATGCTGCATCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925947263 Original CRISPR AAGCTTATGCTGCATCTCAC TGG (reversed) Intronic
902929109 1:19717798-19717820 AACCAAATGCTGCATCTCAAGGG - Intronic
906842289 1:49152507-49152529 ATGCTTTTGATGCAACTCACAGG - Intronic
909544968 1:76836211-76836233 AAGCTTATTCTTCATGTAACAGG - Intergenic
913018308 1:114762076-114762098 AAGCTTATGCTGTAGTTCAGAGG - Intergenic
914225517 1:145716737-145716759 CTGCTTCTGCTTCATCTCACGGG + Intergenic
915781706 1:158559075-158559097 CAGCTTTTGCTGCATCTCATCGG - Intergenic
916015117 1:160742829-160742851 GGGCTTAGGCTGTATCTCACGGG + Intronic
916627642 1:166575585-166575607 AAGCATTTGCTGCATTTCAAAGG - Intergenic
921387760 1:214588062-214588084 AATCTTATGCAGGATCCCACGGG + Intergenic
922802250 1:228369810-228369832 AAGCTGAGCCTGGATCTCACTGG + Intronic
1065530480 10:26665024-26665046 CAGCTCATGCTGCTTCTTACTGG + Intergenic
1066659251 10:37723577-37723599 TTGCTTTTGCTGCATCCCACAGG - Intergenic
1067034547 10:42903330-42903352 CTGCTTCTGCTGCATCACACAGG - Intergenic
1067846962 10:49732175-49732197 ATGCTGATACTGCATCTAACAGG - Intergenic
1069247737 10:66228323-66228345 CTGCTTTTGCTGTATCTCACAGG + Intronic
1069421116 10:68247437-68247459 TAGCTTATGATACATATCACAGG - Intergenic
1070454495 10:76598780-76598802 AAGCTGATGCTGCAGTCCACAGG - Intergenic
1070580543 10:77715879-77715901 AACCCTATGCTGGATGTCACAGG + Intergenic
1075437605 10:122457199-122457221 AAGATTGGGCTGCATCTCAAGGG - Exonic
1075816518 10:125268823-125268845 AAGCATTTGCTGCATCTGGCAGG - Intergenic
1075964069 10:126595333-126595355 AAGCACATTCTGCATCTCAGTGG - Intronic
1078246919 11:9582053-9582075 AAATTTTTGCTGCATCTTACAGG + Intronic
1078505847 11:11944224-11944246 AGCCTTATGCTTCATCTCATGGG + Intronic
1080044151 11:27790703-27790725 AAGATTATTCTGCATCACCCAGG + Intergenic
1081005829 11:37737646-37737668 AAGCTTTGTTTGCATCTCACTGG - Intergenic
1082737463 11:56872789-56872811 AAGGTCATGGTGGATCTCACAGG + Intergenic
1085348106 11:75781032-75781054 AAGCTGATTCTCCATCACACTGG - Intronic
1086864170 11:91959812-91959834 ATGCTTCTGCTGCATCATACAGG - Intergenic
1087049051 11:93867983-93868005 AAGCTTGTGCTGGATATCAGGGG + Intergenic
1087898211 11:103611172-103611194 AGGCTAATGCTCCAGCTCACAGG + Intergenic
1091598489 12:1899152-1899174 CTGTTTTTGCTGCATCTCACAGG - Intronic
1093272758 12:17084480-17084502 AAGCTGATGGTGCAACTCTCAGG - Intergenic
1094726312 12:33120519-33120541 TTGCTTTTGCTGTATCTCACAGG + Intergenic
1095915788 12:47476275-47476297 AACCTTGTCCTGGATCTCACTGG - Intergenic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1098388864 12:69948061-69948083 AAGCTTATAATGAATATCACTGG + Intronic
1100920784 12:99484069-99484091 AACCTTATGTTGTATCTCAAGGG - Intronic
1105274760 13:18909534-18909556 CTGCTTTTGCTGCATCCCACAGG + Intergenic
1111030767 13:82594557-82594579 CTGCTTTTGCTGCATCTCACAGG - Intergenic
1115338402 14:32266037-32266059 TTGCTTTTGCTGCATCTCACAGG - Intergenic
1117091168 14:52252068-52252090 AAAATTAAGCTGCTTCTCACTGG - Intergenic
1118896296 14:69948603-69948625 TTGCCTATGCTGCAGCTCACAGG - Intronic
1122679667 14:103448508-103448530 ATGCTTATGATGTATTTCACTGG + Intronic
1130966276 15:88700130-88700152 AAGCATGGGCTGCCTCTCACTGG - Intergenic
1131252724 15:90840840-90840862 AAGCTTTTGCGGAATCTCCCTGG + Intergenic
1131720459 15:95162849-95162871 TAGTTTATGCAGAATCTCACTGG + Intergenic
1134006363 16:10821139-10821161 AAGCTGATGCTGCTGCTCCCTGG + Intergenic
1134895579 16:17883867-17883889 AACCTTAAGCTGTATCCCACAGG - Intergenic
1137313462 16:47289979-47290001 CAGCTTTTGCTGTATCCCACAGG + Intronic
1138084307 16:54119807-54119829 AAACTTATGTTGCTGCTCACAGG - Exonic
1138825195 16:60310240-60310262 AAGTTTAGAATGCATCTCACTGG - Intergenic
1139729175 16:68928055-68928077 AAGCTTCTCTTGCATCTCAAGGG - Exonic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1144459577 17:15447351-15447373 ATGGTTATGCTGGATCTCAAAGG + Intronic
1147500866 17:40962350-40962372 AAGCTGATGCTGCATTTCTAGGG - Intronic
1147913574 17:43872949-43872971 AAGCTTCTTGTACATCTCACAGG - Intergenic
1149375620 17:56041272-56041294 GATCTTATGCTACATTTCACTGG - Intergenic
1151519356 17:74617197-74617219 AAGATGATGCTGGATCTTACTGG - Exonic
1151968605 17:77445360-77445382 AAGCATCTGCTGCATCCCATTGG + Intronic
1152488290 17:80610273-80610295 AAGCTTTTGCTGCATGTACCAGG - Intronic
1152647912 17:81478458-81478480 AATCTTAAGCTGCAGATCACTGG - Intergenic
1153143713 18:2003734-2003756 CAGCTTAAGCTGTATCCCACAGG - Intergenic
1153828298 18:8897372-8897394 CAGCTTCTGCTGCATGCCACGGG + Intergenic
1154466450 18:14646786-14646808 CTGCTTTTGCTGCATCCCACAGG + Intergenic
1156665769 18:39404734-39404756 AAACATATGCTGCAGCTCAGTGG + Intergenic
1158373709 18:56839094-56839116 AAACTTATGCTGAATCAAACTGG - Intronic
1159335051 18:67051846-67051868 AAGATTATGCTGCATGTATCCGG - Intergenic
1162839263 19:13343810-13343832 CTGCTTCTGCTGCATCTCACAGG - Intronic
1163939428 19:20478536-20478558 AAGCTTGTGCTGAATATCAGGGG + Intergenic
1164003304 19:21126820-21126842 AAGCTTTTACACCATCTCACTGG + Intergenic
1164198972 19:23001097-23001119 AAGTTTTTGCACCATCTCACTGG + Intronic
1165260415 19:34611575-34611597 TAGCTTCTGCTGCATCCCCCAGG + Intronic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
926229292 2:10990606-10990628 AGGCTGAAGCTGCATCCCACCGG + Intergenic
928063609 2:28140072-28140094 ATGCTTTTCCTGCATCTCTCAGG + Intronic
928459723 2:31459309-31459331 CTGCTTTTGCTGTATCTCACAGG - Intergenic
935867380 2:107405071-107405093 AAGCTTATTCTGAACCTCTCAGG - Intergenic
937173849 2:119905938-119905960 ATGCTATTGCTGTATCTCACAGG - Intronic
937766791 2:125670671-125670693 AAGCTTATACAGCATATCCCAGG - Intergenic
938287892 2:130133370-130133392 CTGCTTTTGCTGCATCCCACAGG + Intergenic
938427702 2:131205515-131205537 CTGCTTTTGCTGCATCCCACAGG - Intronic
938468634 2:131539519-131539541 CTGCTTTTGCTGCATCCCACAGG - Intergenic
940340135 2:152571399-152571421 AAACTGATGCTGCCTCTCACTGG + Intronic
941734024 2:168952866-168952888 CTGCTTTTGCTGTATCTCACAGG + Intronic
942552776 2:177137092-177137114 AAGCTTATGCTTTATGTCCCTGG - Intergenic
943026485 2:182635923-182635945 AAGCTTCTGCTCGATCTCACCGG + Intergenic
943920136 2:193696540-193696562 GAGCTGATGCTGCAGCCCACAGG + Intergenic
948123016 2:235544696-235544718 AAACCAATGCTGCCTCTCACAGG + Intronic
948420113 2:237853286-237853308 CTGCTTATTCTGCTTCTCACTGG - Intergenic
948715875 2:239862914-239862936 AAACTTAACATGCATCTCACCGG - Intergenic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1171187955 20:23136932-23136954 CAGCTGCTGCTGCTTCTCACTGG - Intergenic
1176808143 21:13511811-13511833 CTGCTTTTGCTGCATCCCACAGG - Intergenic
1178147287 21:29754820-29754842 AAGCTGATGCTGCAGTCCACAGG - Intronic
949884867 3:8684803-8684825 AAGCTTATGTTGAATATCGCAGG - Intronic
950292937 3:11801674-11801696 CTGCTTTTGCTGCATCCCACAGG - Intronic
953121166 3:40044046-40044068 CAGCTTCTGCTTCAGCTCACTGG - Exonic
954538372 3:51378014-51378036 AAGCTCATGCTGCATCTTGTAGG + Intronic
954928263 3:54256577-54256599 AAGTTTATGCTGCTTCCCAGAGG + Intronic
956262745 3:67362937-67362959 AAGCCTAGGCCCCATCTCACGGG - Intronic
957552922 3:81730290-81730312 AAGCATATACTGTATCTTACTGG - Intronic
960436388 3:117632227-117632249 AAGCATATGCTGCTTCTGAGGGG + Intergenic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
964505003 3:157389819-157389841 AAGCTGATCTTGCATCTCTCTGG - Intronic
965029729 3:163350272-163350294 AAGCTTATGCTCCAGTTCAAAGG - Intergenic
967636871 3:191812198-191812220 ATGCTTTTGCTGTATCACACAGG - Intergenic
969019438 4:4129945-4129967 AAGGTTATGTTGAATATCACAGG + Intergenic
970641377 4:18069934-18069956 AAGCTGATGCTGCAGTCCACGGG - Intergenic
971576674 4:28283430-28283452 CTGCTTTTGCTGCTTCTCACAGG - Intergenic
974093577 4:57337775-57337797 AAGCTTTAGCTTCATTTCACGGG - Intergenic
975275341 4:72492395-72492417 AAGCTTTTGCTGAATCCCATGGG + Intronic
975967176 4:79987187-79987209 AACCTTCTCCTGTATCTCACTGG - Intronic
976324764 4:83758683-83758705 AAGTTTTTGTTGCATCTCATTGG + Intergenic
977522012 4:98096451-98096473 ATGCTTTTGCTGTATCTCATAGG - Intronic
979599164 4:122568385-122568407 CTGCTTTTGCTGCATCTCATAGG + Intergenic
979914834 4:126418299-126418321 ATGCTTTTGCTGTATCCCACAGG + Intergenic
980562191 4:134491867-134491889 CTGCTTTTGCTGCATCCCACAGG - Intergenic
980647149 4:135656823-135656845 CAGCTTTTACTGCATCTCATAGG - Intergenic
983179073 4:164626283-164626305 TAGCTTGTGCTGTATCCCACAGG - Intergenic
983339480 4:166440262-166440284 TGGCTTTTGGTGCATCTCACAGG - Intergenic
983543107 4:168933993-168934015 ATGCTTTTGCTGTATCACACAGG - Intronic
988082356 5:26430305-26430327 AAGATTTTGCTGCATTTCCCTGG - Intergenic
988102291 5:26696069-26696091 TAGCTTTTGCTGTATCTCATAGG - Intergenic
989047528 5:37287302-37287324 AAGCTCAAGCTGCGTCTCAAGGG + Intergenic
989691407 5:44149301-44149323 AAGCTTATTTTGCTTCTCCCCGG - Intergenic
991402495 5:66267784-66267806 CTGCTTCTGCTGCATCTCATAGG + Intergenic
992657325 5:78923184-78923206 TGGCTCATGCTCCATCTCACTGG + Intronic
992719048 5:79541500-79541522 AAGCTTATGCTACTTCTAACTGG - Intergenic
998856609 5:146400474-146400496 CAGCATCTGCTGCATCTCAGAGG - Intergenic
1003124017 6:3340896-3340918 AAGCTTATGCTCCTTCTTTCAGG + Intronic
1003678278 6:8227209-8227231 AAGCTGATTCTGCAACTAACTGG + Intergenic
1005072289 6:21873014-21873036 AAGCATATGTTGAAACTCACTGG - Intergenic
1006903012 6:37515125-37515147 AAGGCTATGGTGCATCTCATGGG - Intergenic
1011359467 6:86507566-86507588 CTGCTTTTGCTGCATCTCATAGG + Intergenic
1011391242 6:86856058-86856080 AATCTTATGATGCATTTCCCAGG - Intergenic
1011404484 6:87003615-87003637 AACCTTTTGCTGTATCCCACAGG - Intronic
1011673766 6:89710751-89710773 AAGCCAGTGCTGCATCTCTCAGG - Exonic
1014501436 6:122194998-122195020 AAGCTTATGCTGGATCATAAAGG + Intergenic
1014583339 6:123165172-123165194 CTGCTTTTGCTGCATCTCATAGG - Intergenic
1016559479 6:145378901-145378923 AGCCTCCTGCTGCATCTCACTGG - Intergenic
1017556074 6:155570413-155570435 CAGCTTTTGCTGTATCTCAGAGG + Intergenic
1018474449 6:164125993-164126015 AGGCTTTTGCTCCATCTCCCAGG + Intergenic
1018550161 6:164987935-164987957 AATCATATTCTGCATCTCTCAGG + Intergenic
1019054659 6:169214322-169214344 ACGCTGATGCTGCTGCTCACAGG - Intergenic
1019572904 7:1721563-1721585 AAGCTGAACCTTCATCTCACAGG - Intronic
1019642353 7:2110816-2110838 AAGCGCTTTCTGCATCTCACAGG + Intronic
1020997141 7:15279068-15279090 AAGGTCATGTGGCATCTCACAGG - Intronic
1021831374 7:24615121-24615143 CTGCTTTTGCTGTATCTCACAGG - Intronic
1025992442 7:66506082-66506104 AAGCTGCTGCTGCTCCTCACGGG - Intergenic
1027808089 7:82855761-82855783 AAAATTATGCTGAATCTTACTGG + Intronic
1030046069 7:105497259-105497281 AACCTTTTGCTTCATCTCATGGG - Intronic
1030569114 7:111199624-111199646 AAGCTTATGCTTCTTCTAATTGG - Intronic
1030620356 7:111783186-111783208 AAGATTATGCTCCCTCTCAATGG + Intronic
1034980378 7:155472002-155472024 AAGTTAATGCTGCAGCTCAGTGG + Intergenic
1035184367 7:157114330-157114352 AGTCTTATGCTGCACCTCATTGG + Intergenic
1035347220 7:158210030-158210052 CTGCTTTTGCTGCATCCCACAGG - Intronic
1036753729 8:11458874-11458896 AATCTTCTGGTGCATTTCACTGG - Intronic
1039492933 8:37961464-37961486 ATGCTTCAGCTGCTTCTCACTGG + Intergenic
1041160040 8:55031303-55031325 AAGCTTTTGTTGCATCCCATAGG - Intergenic
1042261398 8:66863691-66863713 CTGCTTTTGCTGCATCCCACAGG - Intergenic
1042372376 8:68006291-68006313 CAGGTTATACTGCATCTCAGCGG - Intronic
1043868704 8:85404797-85404819 AAGCAGATGCTGCATGTCAAAGG + Intronic
1044626330 8:94237595-94237617 AACCCTCAGCTGCATCTCACAGG - Intergenic
1045349718 8:101328007-101328029 AAGCTCAAACTGCCTCTCACTGG - Intergenic
1045706890 8:104934316-104934338 CAGCTTCTGCTGTATCACACAGG - Intronic
1045875774 8:106979158-106979180 AAGGTTATGCTGCTGCTAACTGG - Intergenic
1046113878 8:109761939-109761961 CTGCTTTTGCTGTATCTCACAGG + Intergenic
1047394880 8:124487508-124487530 AAGCTGCTGCTGAATCTGACAGG + Exonic
1048002375 8:130389479-130389501 AATCTTATTTTGCATTTCACAGG + Intronic
1050185045 9:2964439-2964461 CAGCTTCTGCTGTATCACACTGG - Intergenic
1052336980 9:27330258-27330280 AAGCTTAGGCGGCAGGTCACAGG + Exonic
1052820066 9:33131298-33131320 AAACTTCTGCTCCATGTCACAGG - Intronic
1058765558 9:108179612-108179634 AAGTTTATTTGGCATCTCACTGG + Intergenic
1059069747 9:111123007-111123029 AAGCATATGCTGCATCCTATAGG + Intergenic
1059511117 9:114848263-114848285 AAGCTTGTGATGAATCTCAAAGG + Intergenic
1060017626 9:120100364-120100386 AAGCTGCTCCTGCATTTCACTGG - Intergenic
1186374002 X:8979137-8979159 AAGCTTTTGCTGTATCTAATAGG + Intergenic
1186902220 X:14068917-14068939 AGGCTGGTGCTGAATCTCACAGG + Intergenic
1188118590 X:26277177-26277199 CTGCTTTTGCTGTATCTCACAGG + Intergenic
1190027936 X:46943428-46943450 AAGCTTTTGCTGCATCTATTTGG + Intronic
1192046717 X:67683171-67683193 ATGCTTATGTTGCATGTGACTGG + Intronic
1193166085 X:78282063-78282085 AAGCTTATGGCACATGTCACTGG - Intronic
1193211666 X:78813371-78813393 ATGCTTTTGCTGTATTTCACAGG - Intergenic
1194505039 X:94723899-94723921 CTGCCTATGCTGCATCACACAGG + Intergenic
1195512307 X:105730843-105730865 ATGCTTTTGCTGTATCCCACAGG - Intronic
1198300660 X:135331633-135331655 AGGCTTATTTTGCAGCTCACAGG - Intronic
1198885022 X:141325972-141325994 CTGCTTTTGCTGCATCCCACAGG - Intergenic
1198943296 X:141982317-141982339 ATGCTTCTGCTGCATCATACAGG + Intergenic
1199247952 X:145628906-145628928 ATGCTTTTGCTGCATCCCATAGG - Intergenic
1199856698 X:151764805-151764827 AAGCTGATGCTGCAGTCCACAGG - Intergenic
1202023851 Y:20498715-20498737 CTGCTTTTGCTGAATCTCACAGG + Intergenic