ID: 925952095

View in Genome Browser
Species Human (GRCh38)
Location 2:8924353-8924375
Sequence GTGCAGGTCTTTAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925952095_925952100 25 Left 925952095 2:8924353-8924375 CCTTCCTTCCTAAAGACCTGCAC 0: 1
1: 0
2: 1
3: 17
4: 214
Right 925952100 2:8924401-8924423 CTCTGCTGTTCTACGAAGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 91
925952095_925952101 26 Left 925952095 2:8924353-8924375 CCTTCCTTCCTAAAGACCTGCAC 0: 1
1: 0
2: 1
3: 17
4: 214
Right 925952101 2:8924402-8924424 TCTGCTGTTCTACGAAGTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925952095 Original CRISPR GTGCAGGTCTTTAGGAAGGA AGG (reversed) Intronic
902069619 1:13723228-13723250 GTGCAGTGCTTTAGTTAGGATGG - Intronic
905500755 1:38434404-38434426 ATGCAAGATTTTAGGAAGGAGGG + Intergenic
908803496 1:67905669-67905691 GTCTAGGTCTCTAGCAAGGATGG + Intergenic
909381428 1:75003424-75003446 TTGCAGGACTTTGGCAAGGACGG - Intergenic
910846097 1:91606120-91606142 GTGCAGGTGTTAAGTAAGGGTGG - Intergenic
910919434 1:92328193-92328215 GTGTAGGTCTCTAGCAAGGCTGG + Intronic
911870919 1:103097371-103097393 GTGAAGGCCTTTATGAAGGGAGG - Intronic
917198563 1:172492273-172492295 GAGAAGGAGTTTAGGAAGGAAGG - Intergenic
918130024 1:181619347-181619369 GTGAAGGCCCTGAGGAAGGAGGG + Intronic
918750659 1:188265570-188265592 GTTCAGGTCTCTAGCAAGGCTGG + Intergenic
922216699 1:223525951-223525973 AGGCAGGTCTTTATGATGGAGGG + Intergenic
1063490498 10:6459400-6459422 GTGCAGGTCTTTGTCAAGCATGG - Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1065377210 10:25055382-25055404 ATGCAGGCCTTTAGCCAGGAGGG - Intronic
1066438173 10:35413207-35413229 GTGAAGGTCTGAAGGAAGGTAGG + Intronic
1069697565 10:70398225-70398247 GTGCAGGTGATTAGAAAGAATGG + Intergenic
1070769201 10:79072461-79072483 GTGAAGGGATTTAGGAAGGAAGG + Intronic
1071473892 10:86008199-86008221 GAGCAGGGCCTTAGGAAAGAAGG + Intronic
1072917870 10:99550791-99550813 GTGCATGCCTATAGAAAGGAAGG + Intergenic
1073366012 10:102941652-102941674 GTACAGATCTGAAGGAAGGAGGG - Intronic
1074751588 10:116592076-116592098 GAGCAGGTCTTTAGTAATGTTGG + Intronic
1076361674 10:129894056-129894078 GAGCAGGTTAATAGGAAGGAGGG - Intronic
1076458598 10:130622708-130622730 GTGCTGGTCTTATGGAGGGATGG - Intergenic
1076460569 10:130642319-130642341 GGGCAGGTTTTTTGGGAGGAGGG - Intergenic
1076878586 10:133229441-133229463 GTGGTGGGTTTTAGGAAGGAAGG - Intergenic
1077434623 11:2532854-2532876 GTGCAGGGTTGCAGGAAGGACGG + Intronic
1078337105 11:10473357-10473379 CTCCAGGTCTTTAGGGAGGAAGG + Intronic
1080699249 11:34630649-34630671 GTGCAGGAATGTAGGAAGGGTGG - Intronic
1081660743 11:44886694-44886716 TTACAGATCTTTAGGAAGGAAGG - Intronic
1085803716 11:79615190-79615212 GTGCAGTTCTTTAGCAAGTCTGG - Intergenic
1088239663 11:107760141-107760163 GTCTAGGTCTCTAGGAAGGCTGG - Intergenic
1088592400 11:111414939-111414961 TTGCAGGTCTTTGGGGAGGCTGG + Intronic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089043764 11:115480855-115480877 GGGCAAGGCTTTAAGAAGGAGGG - Intronic
1089166371 11:116480368-116480390 GCTCAGGTTTTTAGGAAAGAAGG - Intergenic
1089194053 11:116681572-116681594 ATGGAGGTCTTCAGGAGGGATGG + Intergenic
1089432901 11:118437292-118437314 GATCAGGTCTCTAGGAGGGAGGG - Intronic
1090757453 11:129804945-129804967 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
1091171667 11:133525324-133525346 GTGAAGCCCTTGAGGAAGGAGGG + Intronic
1091241482 11:134055294-134055316 GTGCAGGTCTTTAGAATCAAAGG + Intergenic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1094173406 12:27518335-27518357 GTGCATGTTGATAGGAAGGATGG + Intergenic
1094585614 12:31774809-31774831 GGGCAGTTCTTTGGGAAGAAGGG + Intergenic
1096081046 12:48832729-48832751 GAGCAGGTACTCAGGAAGGATGG - Intronic
1104750218 12:131233580-131233602 GTTCAGGGCTTTAGGAAGCCTGG - Intergenic
1104782498 12:131430881-131430903 GTTCAGGGCTTTAGGAAGTGTGG + Intergenic
1105908405 13:24836227-24836249 GTCCAGGTCTCTAGCAAGGCTGG - Intronic
1105991394 13:25625553-25625575 GTGAAGGTCTTTGGGGAGGCAGG + Intronic
1106002138 13:25734207-25734229 GAGAAGGTAATTAGGAAGGAGGG - Intronic
1106525985 13:30541814-30541836 TTGCATGACTTTAGGAAGCATGG + Intronic
1110881701 13:80579254-80579276 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1113036969 13:106061524-106061546 ATGCAGGTCTTATGGAAGAATGG - Intergenic
1113304049 13:109057544-109057566 TTGCAGGGCTTTGGGAAGGACGG + Intronic
1116370914 14:44130591-44130613 GTGCATGTCTAGAGGAGGGAGGG + Intergenic
1116738285 14:48722488-48722510 GTGCACAGCTTTATGAAGGATGG - Intergenic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1119568578 14:75649871-75649893 GAGCAGGCCGTTAGAAAGGAGGG - Exonic
1120525458 14:85571868-85571890 GTGTATGTGTTTTGGAAGGATGG + Intronic
1122964998 14:105119303-105119325 GTGCAGGTTTTTTTGAGGGATGG - Intergenic
1124229889 15:27935427-27935449 GCCCAGGGCTTTAGGAATGAGGG - Intronic
1125958147 15:43805376-43805398 CTGCATGACTTTAGGAAGAATGG + Exonic
1126111535 15:45178025-45178047 TTCCAGGTCCTTAGGGAGGATGG - Intronic
1131492986 15:92879155-92879177 GTGCTGATCTTTAGGAGGGAAGG - Intergenic
1133404364 16:5511023-5511045 GAGGAGGTCCTTTGGAAGGAAGG + Intergenic
1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG + Intergenic
1135202997 16:20455249-20455271 GTCTAGGTCTTTAGCAAGGCTGG - Intronic
1135216101 16:20572613-20572635 GTCTAGGTCTTTAGCAAGGCTGG + Intronic
1136179225 16:28539338-28539360 ATGCAGGACGTGAGGAAGGAGGG + Intergenic
1137473160 16:48780960-48780982 GTGCATGTGTTGAGGAAGAATGG - Intergenic
1138181745 16:54945211-54945233 GTGGTTGGCTTTAGGAAGGAGGG - Intergenic
1138891071 16:61144758-61144780 CTGAGGTTCTTTAGGAAGGAAGG + Intergenic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1143510622 17:7393584-7393606 GTGCAGGTGAGTGGGAAGGAGGG - Exonic
1143688036 17:8534987-8535009 GTGCGGGTGGTGAGGAAGGACGG + Intronic
1144117421 17:12111960-12111982 GTGCAGCTCTGTAGGGAGTATGG + Intronic
1144312275 17:14024342-14024364 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1144332484 17:14236983-14237005 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1144498343 17:15764530-15764552 GAGTAGGTCTTATGGAAGGAAGG + Intergenic
1149420733 17:56508706-56508728 GTGTAGGTATATAGGAAAGAGGG - Intronic
1149513041 17:57258107-57258129 GTGGAGGGCTGTAGGCAGGAGGG + Intronic
1153718443 18:7875632-7875654 GTTCAGGTCTTTGGCAAGAATGG - Intronic
1156242025 18:35264038-35264060 TTGCAGCTCCTCAGGAAGGATGG + Exonic
1157294577 18:46433418-46433440 GTGCAGGGCCTGAGGTAGGAAGG - Exonic
1158069589 18:53455134-53455156 GGGGAAGTCTTCAGGAAGGAAGG - Intronic
1158945166 18:62441736-62441758 GTGCAGGTTTTAAGGAAAGGCGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159773404 18:72575490-72575512 GGGAAGGTTTTTAGGAAGGGGGG + Intronic
1159820659 18:73138755-73138777 GTGTAGGTCTTTAGCAGGGTTGG - Intergenic
1161773140 19:6242116-6242138 GAGCAGGTCTTGAGGCAGGGAGG - Intronic
1163003112 19:14381407-14381429 GGCCAGGACTTTATGAAGGAGGG - Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1165275282 19:34745710-34745732 TAGCAGGTCTATGGGAAGGAAGG + Intergenic
925266650 2:2570916-2570938 GTCCAAGTCTCTAGGAGGGAAGG + Intergenic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926303758 2:11622413-11622435 GTGCATGTCCATAGGAAGGCAGG - Intronic
926999080 2:18773457-18773479 GTGAGGGTCATGAGGAAGGAAGG - Intergenic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
927478533 2:23432729-23432751 GTGCAGGTGCTGAGGCAGGAGGG + Intronic
928649397 2:33388856-33388878 CTTCAGGCCTTTTGGAAGGATGG - Intronic
928671002 2:33603385-33603407 TTGCTGGTCTTGATGAAGGAGGG - Intergenic
928748427 2:34442964-34442986 GAGCACCTCTTCAGGAAGGAGGG - Intergenic
929028170 2:37625562-37625584 GTGCTGGATTTCAGGAAGGATGG - Intergenic
930035528 2:47083076-47083098 GTGCAGGGCTTGATGAAGGCTGG - Intronic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
935182550 2:100703901-100703923 GTGCAGGTCCATGGGAAGAAAGG + Intergenic
936465713 2:112747520-112747542 ATGCAGGTGTTTATGAAAGAGGG + Intronic
937114094 2:119391890-119391912 GCCCAGGTCTGGAGGAAGGAAGG + Intergenic
938265946 2:129928311-129928333 GGGCAGGTCTTGAGATAGGATGG + Intergenic
940431376 2:153593632-153593654 GTGTAGGGGTTTAGGAAAGATGG + Intergenic
941428580 2:165383376-165383398 GTGAAGGTCCTTATGTAGGAGGG + Intronic
943896786 2:193372897-193372919 TTCCAGGTATTAAGGAAGGAAGG - Intergenic
944083107 2:195812183-195812205 GGGCAGGGCGTTAGGGAGGAGGG - Intronic
944413173 2:199461931-199461953 GAGCGGGCCTCTAGGAAGGAAGG - Intronic
945777202 2:214120504-214120526 GTGCAGGTTTCTAGGAAACAAGG - Intronic
946391161 2:219417867-219417889 GTGGGGGTCTCTAGGCAGGAAGG - Intergenic
947524744 2:230871285-230871307 GAGCAGGTCTTAAGGAAAGGTGG - Intronic
947737098 2:232461246-232461268 ATTTTGGTCTTTAGGAAGGAGGG + Intergenic
948293498 2:236844636-236844658 GTGCAGCTGTGTAGGAGGGAAGG - Intergenic
1169417917 20:5433295-5433317 GTGAAGGGCTTTAGACAGGAGGG - Intergenic
1170615415 20:17945213-17945235 GTGTAGGTCTAGAGGAAGGCAGG - Intronic
1170863000 20:20126754-20126776 GTCCAGGTCTCTAGCAAGGCTGG + Intronic
1171027929 20:21649109-21649131 GTCCAGGTCTCTAGCAAGGCTGG - Intergenic
1172563136 20:35906854-35906876 ATGCAGGGCTTGAGGAGGGAGGG + Intronic
1173941397 20:46914120-46914142 GGACAGCTCTTTAGGAACGAGGG - Intronic
1174071851 20:47905113-47905135 GGGCAGGTCGTCATGAAGGAGGG + Intergenic
1174152202 20:48493556-48493578 GGGCAGGTCGTCATGAAGGAGGG - Intergenic
1174586347 20:51611350-51611372 GTGCCGCTGCTTAGGAAGGATGG + Intronic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1179518917 21:41929425-41929447 GTGCAGGGCTGTGGGAAGCAGGG - Intronic
1180250847 21:46586669-46586691 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
1181412177 22:22731635-22731657 GAGTAGGTCTTATGGAAGGAAGG - Intergenic
1182120022 22:27780349-27780371 GGGCAGGTCCTAAGGCAGGACGG - Intronic
1182151246 22:28028599-28028621 GTGAAGGACTTGAGGTAGGAAGG + Intronic
1182297540 22:29318581-29318603 CTGCTGGTCTTTAGGAAGCCTGG - Intronic
1182865092 22:33597521-33597543 GTGCTGGTCTCTATGGAGGATGG - Intronic
1184313855 22:43667099-43667121 GTGCATGACTTTAAGAAGGTAGG - Exonic
1184448860 22:44571031-44571053 TTGCAGGGCTTTAGGGAGGAGGG + Intergenic
959458988 3:106601018-106601040 GGGGAGTGCTTTAGGAAGGATGG + Intergenic
959557843 3:107742824-107742846 TTGCAAATCTTTAGGATGGATGG - Intronic
961942340 3:130650872-130650894 CTGCAGGTCTTTTGTAAGGGTGG + Intronic
962764746 3:138550974-138550996 GTCTAGGTCTTTAGCAAGGCTGG - Intronic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
963038674 3:141052770-141052792 GCGCAGGGCTCTGGGAAGGAGGG + Intronic
963213355 3:142718324-142718346 GTCTAGGTCTTTAGCAAGGCTGG - Intergenic
963317222 3:143772446-143772468 GTACAGATATTTGGGAAGGAAGG + Intronic
963851903 3:150217649-150217671 GTGCAGGTGTTTGGGGAGGTGGG + Intergenic
965171388 3:165269293-165269315 CTGCATGTCTTTGGGGAGGAAGG + Intergenic
965321740 3:167260371-167260393 GTCTAGGTCTCTAGGAAGGCCGG + Intronic
966167849 3:177041283-177041305 GTGTATGTTTTTGGGAAGGAGGG + Intronic
968064696 3:195752206-195752228 GTGCAGGGCATTAGGAAGTGAGG - Intronic
968882374 4:3307997-3308019 GTGCAGGGGCTTAGGAAGCATGG + Intronic
969862931 4:10051951-10051973 CTGGAGGGCTTTAGGAAGGGTGG - Intronic
975459146 4:74630187-74630209 GTGGTGGTCTGTAGGAAGCATGG - Intergenic
977352763 4:95909262-95909284 GGGAAGGTCTTTATGAATGATGG + Intergenic
977510602 4:97957522-97957544 GTCTAGGTCTTTAGCAAGGCTGG - Intronic
978616662 4:110603791-110603813 GTGCAGATTTGGAGGAAGGAAGG - Intergenic
979030030 4:115632336-115632358 GTCCAGATCTTTAGCAAGGCTGG + Intergenic
980158376 4:129132939-129132961 GAGCAGGTCTTATGGAAGGAAGG + Intergenic
980876050 4:138663368-138663390 GAGAAGGTCTTTAGGCAAGAGGG - Intergenic
981510917 4:145557533-145557555 TTGCTGGTCTTGAGGAATGAAGG - Intronic
981576571 4:146212220-146212242 GCGCAGGTCTGTACAAAGGAAGG - Intergenic
982414924 4:155119232-155119254 GACCAGGTATTTAAGAAGGAGGG - Intergenic
988412695 5:30907676-30907698 ATTCAGGTCTTTAGGATGGGAGG - Intergenic
989603933 5:43226124-43226146 GAGAATGACTTTAGGAAGGATGG + Intronic
991321592 5:65379670-65379692 GTGCATGTGTTTAGGAGGGCTGG - Intronic
992760564 5:79947846-79947868 GTGCAGTAGTTTAGGAGGGAGGG + Intergenic
992995385 5:82327789-82327811 GTGCAGGCCTTTTGGAAGGGAGG + Intronic
993883744 5:93393647-93393669 GTGTAGGTCTCTAGCAAGGCTGG + Intergenic
993886753 5:93423842-93423864 GTGAAGGCCTTTAAGATGGAGGG - Intergenic
995451004 5:112300682-112300704 GTTTAGGTCTTTAGCAAGGCTGG + Intronic
997880713 5:137587108-137587130 TTGAAGGTTTTTAGGAAGGAAGG + Intronic
999784016 5:154874876-154874898 TTTCAGGGCTTTAGGAAGGCTGG + Intronic
1000344965 5:160306957-160306979 ATGCAGGTCTGTAGGAAGCTGGG + Intronic
1000560345 5:162779458-162779480 GTGAAGTGCTTTAAGAAGGAAGG - Intergenic
1000836600 5:166162189-166162211 GAGCAGGACTTCATGAAGGAAGG - Intergenic
1001198270 5:169693155-169693177 ATGGAGGTCATTATGAAGGAAGG + Intronic
1001941824 5:175745455-175745477 CTGCAGCTCTCTAGGAATGAGGG + Intergenic
1001977188 5:176009768-176009790 CTGCAGGTCTTCAGGCTGGAGGG - Intronic
1002240237 5:177834012-177834034 CTGCAGGTCTTCAGGCTGGAGGG + Intergenic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1003754827 6:9105030-9105052 GACCAGGTCTTTTTGAAGGATGG - Intergenic
1011132992 6:84071619-84071641 GTCTAGGTCTCTAGGAAGGCTGG + Intronic
1012173292 6:96046557-96046579 GTGTAGGTCTTCAGGATGGGTGG - Intronic
1014293929 6:119594700-119594722 GTGTATGTATTTAGGGAGGAGGG - Intergenic
1014304690 6:119726347-119726369 GTGTAGGTCTCTAGCAAGGCCGG + Intergenic
1015222293 6:130817870-130817892 GTCTAGGTCTTTAGCAAGGCCGG - Intergenic
1017732481 6:157329819-157329841 GTTCAGAACTTTAGGCAGGAAGG + Intergenic
1018977228 6:168574743-168574765 GTGCCGGTCTTCAGGGAGGTCGG - Intronic
1022479270 7:30732669-30732691 GTGCACAGCTTTAGGAAGGCAGG - Intronic
1023842935 7:44106971-44106993 CTGAAGGTCTATAGGAAGCAGGG - Intronic
1023851206 7:44151487-44151509 GGGCTGGTCTTCAGTAAGGATGG - Intronic
1024800443 7:53071739-53071761 ATGCAGGTCCTTAGTATGGAAGG + Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1026372942 7:69719832-69719854 GTTCAGGGCTTTATGAAGGAAGG + Intronic
1026808302 7:73441883-73441905 GAGCAGGCCCTTAGGAAAGAAGG + Intronic
1028378491 7:90173322-90173344 GTGCAAGTCTTTGGGTAGAAGGG - Intronic
1029057091 7:97758152-97758174 GTGAGGGTCTTTTGGAATGAGGG + Intergenic
1030362656 7:108611002-108611024 GTGCAGGGCTTTAGGCTGGCAGG + Intergenic
1031611970 7:123838674-123838696 GTTCAGGTCTCTAGCAAGGCTGG + Intronic
1031970131 7:128058839-128058861 GGGCTGGTTTTAAGGAAGGAGGG - Intronic
1034817863 7:154189106-154189128 CTGCAGGTTGTTAGGAAGTAGGG + Intronic
1035047259 7:155975792-155975814 CAGCAGGACTTTAGGAAGAAAGG + Intergenic
1035319937 7:158022300-158022322 GTGGAGGCCGTCAGGAAGGATGG - Intronic
1036066901 8:5390651-5390673 GGGCAGGCCTTGGGGAAGGAAGG + Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1039471147 8:37814518-37814540 GTGAAGGGCTTGAGCAAGGATGG + Intronic
1041819054 8:62008861-62008883 GTACAGGACTTAAGGAAGGAAGG + Intergenic
1042508599 8:69588192-69588214 ATGCAGGTCTGTAAGAGGGAGGG - Intronic
1042995670 8:74694928-74694950 GTCCAGGTCTCTAGCAAGGCTGG - Intronic
1045404102 8:101847957-101847979 GTTCAGGTCTGTAGTAGGGATGG + Intronic
1047192715 8:122692868-122692890 GATCAGGTCTGTAGGAAGGTGGG - Intergenic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1051211258 9:14747020-14747042 GTGCAGTTCTTTGGAAATGAGGG + Exonic
1056144014 9:83711322-83711344 GTGCAGGTAATTATGACGGAAGG - Intergenic
1057054907 9:91952765-91952787 TTGCAGGCCTTAAGAAAGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057714821 9:97484272-97484294 CTGCAGGGCTTTGGGGAGGAGGG - Intronic
1058185111 9:101845659-101845681 GAGCAGGGCTTTAGAAAGGAAGG - Intergenic
1059014965 9:110505607-110505629 CTGGAAGTTTTTAGGAAGGAAGG - Intronic
1190391330 X:49934784-49934806 GTGCTTGTCTTTGGGAAGGAGGG - Intronic
1190753234 X:53380272-53380294 GGGCAGGTATGTAGGGAGGAGGG - Intronic
1196225029 X:113156764-113156786 GTGTAGGTCTCTAGCAAGGCTGG + Intergenic
1197162706 X:123342066-123342088 GTCTAGGTCTTTAGGAAATAAGG - Intronic
1197295858 X:124718170-124718192 GTGCAGGTCTAAAGTAAGGCAGG + Intronic
1197715337 X:129702207-129702229 GTGCAGAGCTTTAGGCGGGACGG + Intergenic
1198534940 X:137575747-137575769 GGGCAGGTCATTAGCAAGGCTGG + Intronic
1200079091 X:153566711-153566733 GTGCAGGTGTGCAGGAAGGTTGG - Intronic
1200414996 Y:2900274-2900296 GTGTAGGTCTCTAGCAAGGCTGG - Intronic
1200862822 Y:8010943-8010965 GTGCAGGACTTTGGCAAGAAAGG + Intergenic
1201766458 Y:17577425-17577447 GCTCTGGTCTTTAGGAATGAGGG - Intergenic
1201835094 Y:18328564-18328586 GCTCTGGTCTTTAGGAATGAGGG + Intergenic