ID: 925955028

View in Genome Browser
Species Human (GRCh38)
Location 2:8955018-8955040
Sequence CTCCATTGCAAGCCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925955028_925955036 25 Left 925955028 2:8955018-8955040 CCTGCCCCAGGCTTGCAATGGAG 0: 1
1: 0
2: 5
3: 26
4: 216
Right 925955036 2:8955066-8955088 TGAGGTGCTTTCCACAATTCTGG 0: 5
1: 11
2: 28
3: 45
4: 174
925955028_925955033 7 Left 925955028 2:8955018-8955040 CCTGCCCCAGGCTTGCAATGGAG 0: 1
1: 0
2: 5
3: 26
4: 216
Right 925955033 2:8955048-8955070 CAATTCTAGCCCTACAGCTGAGG 0: 1
1: 1
2: 5
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925955028 Original CRISPR CTCCATTGCAAGCCTGGGGC AGG (reversed) Intronic
901838528 1:11939327-11939349 CTTCAGTTCAAGCCTGGGGTGGG + Intronic
902686005 1:18078129-18078151 AGCCATGGCAAGCCTGGGCCAGG - Intergenic
903084889 1:20847378-20847400 CTGTATTGCAAGCCTGGCCCAGG + Intronic
906114402 1:43346800-43346822 CTCCAGTGCAAGTTTGGGGTGGG - Exonic
907404743 1:54247043-54247065 CTCCAGTGCAGCCGTGGGGCTGG + Intronic
911193747 1:94973267-94973289 ATCCATTGCCAGAGTGGGGCAGG - Intergenic
913338688 1:117734449-117734471 CTCCAGAGCAAGCCTGGGGGCGG - Intergenic
916827057 1:168452559-168452581 GTCCAGAGCAAGCCTGGGGTGGG + Intergenic
917794315 1:178521764-178521786 CTCCAGTGGAGGCCTGGGGTTGG - Intronic
921403596 1:214753828-214753850 CTCCATTGCATGCCCTGGGAGGG + Intergenic
921607713 1:217175024-217175046 CTCCAGTGCTAAGCTGGGGCTGG + Intergenic
922695688 1:227729784-227729806 CACAATTGCAAGCCCAGGGCAGG + Intronic
923065876 1:230517030-230517052 ATCCATTGCAATCCTGAGGCAGG + Intergenic
923396565 1:233571466-233571488 CTATATTGCAAGCCTGGGGCAGG - Intergenic
924441401 1:244088188-244088210 CTGAATTACCAGCCTGGGGCAGG + Intergenic
1063978886 10:11437972-11437994 CTGCATTTCAAGCATGGGACTGG - Intergenic
1069702052 10:70434095-70434117 CTCCATGCCAAGCCTCAGGCGGG - Intronic
1070160694 10:73865216-73865238 CTCCATTGCAGTCCTGGAGGTGG + Intronic
1071827883 10:89343346-89343368 CTTCTTTGCAAGTATGGGGCAGG + Intronic
1072706122 10:97682272-97682294 CTCCCCAGCAGGCCTGGGGCTGG - Intronic
1072799894 10:98385545-98385567 CTCCCTTCTCAGCCTGGGGCTGG - Intronic
1074859103 10:117496824-117496846 CTCCAGTGCAAGTCTGCGTCAGG - Intergenic
1076142413 10:128090389-128090411 ATCCATTGCAAGCCTGGTTAGGG + Intergenic
1076745069 10:132508887-132508909 CTCCATGGCAAGTCCAGGGCCGG + Intergenic
1077886482 11:6391280-6391302 CTCCATTTCCAAACTGGGGCTGG - Intronic
1078460841 11:11514274-11514296 CTGCAGGGCCAGCCTGGGGCAGG - Intronic
1081661195 11:44889441-44889463 CTCCAGAGAGAGCCTGGGGCTGG - Intronic
1082774804 11:57236785-57236807 CTTCATTGCTAGCCTGGCGGTGG - Exonic
1083750494 11:64758314-64758336 CTCCATGGCAACACTGGGCCTGG - Exonic
1083862318 11:65428008-65428030 CTCCACTCCAATCCAGGGGCTGG + Intergenic
1083981951 11:66179423-66179445 CAGCTTTGGAAGCCTGGGGCGGG - Intronic
1084273387 11:68040398-68040420 CTCCTTTCCCAGGCTGGGGCTGG + Intronic
1084858342 11:72002958-72002980 CCCCAGTGCAAGTCTGGGGAAGG + Exonic
1086216036 11:84382563-84382585 ATCCATTGCAAGCCTATGCCAGG + Intronic
1086389353 11:86346425-86346447 CTACATGGAAAGCTTGGGGCAGG - Intergenic
1088470674 11:110185322-110185344 CTCCTTTGCTAACCTGGGGCTGG - Intronic
1088922654 11:114272398-114272420 CTCTACTTCAACCCTGGGGCAGG + Intronic
1089156893 11:116409564-116409586 CTCCATCACAAGACTGGGGTGGG + Intergenic
1089159157 11:116424382-116424404 CTCCAGTGCCTGCCAGGGGCTGG - Intergenic
1089270860 11:117300443-117300465 CTCCATTCCAAGCGGGGGGATGG + Intronic
1092674438 12:10900557-10900579 CCCCATCACAGGCCTGGGGCAGG + Intronic
1094451081 12:30583768-30583790 TTCTATTGTAAGACTGGGGCCGG + Intergenic
1096262775 12:50103496-50103518 CTCCACTGCAGGGCTGGGGTGGG - Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098678088 12:73316140-73316162 CTCAGTTGCAGGCCTGGGGTGGG - Intergenic
1099768379 12:87020596-87020618 CCCCATTGCAGGCCTGGGGCAGG + Intergenic
1102011982 12:109624423-109624445 CTCCATAGCAGGCCTTGGACGGG - Intergenic
1102826367 12:115950790-115950812 CTCCATCCCCATCCTGGGGCAGG + Intergenic
1104041225 12:125132555-125132577 ATCCATTGCAAGCCTAGGAGTGG + Intronic
1104523269 12:129495329-129495351 CTCCATTGTCAGCCTAGGCCAGG - Intronic
1105070846 12:133233727-133233749 CTCCATTGCAGACTTGCGGCCGG + Intronic
1108618057 13:52155086-52155108 CTCAATCGGAAGCCTGGGGGTGG + Intronic
1112035292 13:95491965-95491987 CTCCAGTACCAGCCTGGAGCTGG - Intronic
1112880918 13:104105229-104105251 CCCCAATGTAAGCATGGGGCAGG + Intergenic
1113033965 13:106028093-106028115 CTCTATTTCAAGCCTGCGGAAGG + Intergenic
1114454668 14:22846993-22847015 CAGCATTGGAAGGCTGGGGCCGG + Exonic
1114850971 14:26382094-26382116 CTCACTTGGAAGCCTGGGGTAGG - Intergenic
1115427956 14:33282704-33282726 CTCGACTGCTAGCCTGGAGCGGG + Intronic
1115645087 14:35363719-35363741 CTCCATTGGAAGCCTCTGTCCGG + Intergenic
1115680377 14:35731075-35731097 CTCCACTACCAGCCTGGAGCCGG + Intronic
1115963677 14:38863623-38863645 CCCCATTGTAAGCCTGGGGCGGG - Intergenic
1116781408 14:49241346-49241368 CCCAGTTGCAAGCCTGGGGTGGG - Intergenic
1118603063 14:67483766-67483788 CTCCATGGCAGGGCTGGGCCGGG - Intronic
1119242984 14:73077917-73077939 GTCCTTTGCAAGGCTGAGGCAGG + Intronic
1120444696 14:84579423-84579445 CTCCATGTTAAGCCTGTGGCTGG - Intergenic
1122576654 14:102747200-102747222 CTCCATACCTAGCCAGGGGCTGG + Intergenic
1122919318 14:104873563-104873585 CTCCAGGGAAGGCCTGGGGCAGG + Intronic
1123064038 14:105607155-105607177 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123073352 14:105652798-105652820 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123093277 14:105751565-105751587 GGCCATTCCAGGCCTGGGGCAGG - Intergenic
1123115384 14:105892067-105892089 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1123119637 14:105910785-105910807 CTCCACTGCAGTCCTGGGCCTGG - Intergenic
1123505671 15:20940105-20940127 CTCCATTGCCAGCTTGGAGTAGG - Intergenic
1123562906 15:21513812-21513834 CTCCATTGCCAGCTTGGAGTAGG - Intergenic
1123599152 15:21951095-21951117 CTCCATTGCCAGCTTGGAGTAGG - Intergenic
1125383710 15:39114501-39114523 CCCCATCCCAAGCCTGGGGCAGG + Intergenic
1125482383 15:40089505-40089527 CTCAACATCAAGCCTGGGGCAGG - Exonic
1128233811 15:66053666-66053688 CTCCATTCCCAGCCAGGGCCAGG + Intronic
1130314632 15:82784670-82784692 CTCCCTTGTAAGATTGGGGCTGG + Intronic
1131510962 15:93049238-93049260 CTCCATGCCAGGCCTGGTGCTGG + Intronic
1131585072 15:93684275-93684297 CCCCATTGCAGGCCTAGGGCAGG + Intergenic
1132028647 15:98422651-98422673 AGCCTTTGCAGGCCTGGGGCTGG - Intergenic
1202971257 15_KI270727v1_random:240946-240968 CTCCATTGCCAGCTTGGAGTAGG - Intergenic
1133927185 16:10202781-10202803 CACCATGGCAGGTCTGGGGCAGG - Intergenic
1136627891 16:31472846-31472868 CTCCCTGCGAAGCCTGGGGCTGG + Intronic
1138144277 16:54595047-54595069 CTCAGTTTCATGCCTGGGGCTGG - Intergenic
1139342511 16:66277749-66277771 CTCCATTGCAGACCTGGGGAGGG + Intergenic
1139466526 16:67156880-67156902 CCTCACTGCAAGCCTGGGGCGGG - Intronic
1140907086 16:79418121-79418143 CTTCATTGCCAGCCTGAAGCCGG + Intergenic
1140976034 16:80061255-80061277 CTCCATTGTGAGCCTGGGTTAGG - Intergenic
1141762229 16:86036178-86036200 CCCCGTTGCAAGCATGGGGATGG + Intergenic
1142244635 16:88964258-88964280 CACCAGTGAAAACCTGGGGCAGG + Intronic
1143016307 17:3892859-3892881 CTCCCTTGCAGGCTCGGGGCAGG + Intronic
1143029877 17:3961974-3961996 AGCCATGGCAAGCCTGAGGCAGG + Intronic
1143977986 17:10844427-10844449 CTCCACCCCAACCCTGGGGCTGG - Intergenic
1144427623 17:15158596-15158618 CTGCTTTGGAAGCCTGAGGCTGG - Intergenic
1148804502 17:50257486-50257508 CCCCACTGCAAGTCTTGGGCTGG - Intergenic
1149155456 17:53623860-53623882 CTTCATTTCAAGCTTGGGGTGGG - Intergenic
1149654574 17:58303410-58303432 CATCACTGCAGGCCTGGGGCGGG - Intronic
1150017621 17:61574027-61574049 CTCCATTCCTATCCTGGGCCTGG + Intergenic
1151748754 17:76025232-76025254 GTCCAGTGCAGGCCTGGTGCAGG + Intronic
1151786834 17:76279227-76279249 CTCCCTTCCAGGCCGGGGGCGGG - Intronic
1152516261 17:80826581-80826603 CTTAATTGCTAGGCTGGGGCAGG + Intronic
1153238964 18:3013539-3013561 CCCCATGGCAACCCTGCGGCAGG + Intergenic
1155276141 18:24189452-24189474 CTCCACTGACAGCCGGGGGCTGG + Intronic
1157214138 18:45768264-45768286 CTCCTTTGCAAGTCTAAGGCTGG + Intergenic
1157936092 18:51874499-51874521 CCCTGTTGCAAGCCTGGAGCAGG - Intergenic
1160018442 18:75162185-75162207 CTCTTTAGCAGGCCTGGGGCAGG - Intergenic
1160290755 18:77590950-77590972 CTTCATCCCAAGCATGGGGCAGG - Intergenic
1160440225 18:78883948-78883970 CCCCACTGCAGGCTTGGGGCAGG + Intergenic
1161323375 19:3651602-3651624 CACCATTGCAAGCCAAGGCCCGG + Intronic
1161990780 19:7682917-7682939 CTCCCTCCCCAGCCTGGGGCAGG - Exonic
1163402374 19:17101867-17101889 CGCCATTGCCAGCCTGCGGCTGG + Exonic
1163632526 19:18424668-18424690 CTCCACTGCACACCTGGGCCAGG - Intronic
1165268661 19:34684607-34684629 CTCTATTACAAGTCTGGGGAAGG - Exonic
1165274931 19:34741059-34741081 CTCTATTACAAGTCTGGGGAAGG - Exonic
1167116308 19:47491159-47491181 CTCCATGCCAGGCCTGGGGCTGG + Intronic
1167238061 19:48326820-48326842 CTGCAGTGGAAGCCTGGGGAGGG - Exonic
925653930 2:6124460-6124482 CTCCAGTGTAAGCCTGGGCCTGG + Intergenic
925955028 2:8955018-8955040 CTCCATTGCAAGCCTGGGGCAGG - Intronic
926699824 2:15796272-15796294 GTCAATTGCAACCCTGAGGCAGG + Intergenic
928193649 2:29196924-29196946 ATTCGTTGCAACCCTGGGGCTGG - Intronic
930210899 2:48635595-48635617 CCCTATTGCAAGCCTGGAGTGGG - Intronic
930458577 2:51639150-51639172 CTCAAAAGCAAGACTGGGGCAGG + Intergenic
932216021 2:69966381-69966403 CTCCGTGGCAAGGATGGGGCAGG - Intergenic
933723146 2:85410688-85410710 CTCCATTCAGGGCCTGGGGCAGG + Intronic
934612588 2:95752141-95752163 CTCCAGTGCAAGCCCCGAGCTGG + Intergenic
937320518 2:120958079-120958101 CTCCAGGGCAGGCCTGGGTCAGG + Intronic
937389594 2:121472810-121472832 CTCCATTGAATGCCTTGGGTGGG - Intronic
938642112 2:133291997-133292019 CTCCTTTCCAACCCTGGGGAGGG - Intronic
938899920 2:135791219-135791241 GTCCATTGGAAGCCTGGAGCTGG - Intronic
940408487 2:153332972-153332994 CCCTATTACAAGCCTGGGGTGGG - Intergenic
942047116 2:172106284-172106306 CCCCACCGCTAGCCTGGGGCAGG + Intergenic
944466245 2:200002747-200002769 CTCCTTTGCCTGTCTGGGGCAGG - Intronic
946859791 2:223989957-223989979 CACCATGGCTAGCCTTGGGCTGG + Intronic
947263832 2:228254099-228254121 CTCTGTTGCAGGCCTGAGGCAGG - Intergenic
948174294 2:235930969-235930991 CTTCGTTGTAAGCCAGGGGCTGG + Intronic
948545813 2:238727961-238727983 CTCCTTTGGAAGCATGAGGCTGG + Intergenic
1169076513 20:2763152-2763174 CCCCATTAGAAGCCTGGGGGTGG - Intergenic
1170865587 20:20152787-20152809 CTCCATTGACAGCCTGAGACAGG + Intronic
1171175317 20:23047920-23047942 CTCCATCGCGAGCCTGTGCCTGG - Exonic
1171432401 20:25091338-25091360 CTCCAGAGCAGGGCTGGGGCTGG + Intergenic
1172280408 20:33703809-33703831 CTCCTTTGCCAGCCTCTGGCAGG - Exonic
1174159686 20:48541989-48542011 CTCCACTGCGAGCCTGAGCCTGG - Intergenic
1175184501 20:57170891-57170913 CTCCATTGCTCGCCTTGGCCAGG - Exonic
1175674031 20:60931642-60931664 CCCCTCTTCAAGCCTGGGGCAGG + Intergenic
1175915666 20:62424628-62424650 CTCCATGGGGAGCCTGAGGCTGG + Intronic
1178959106 21:37047703-37047725 CCCCAGTGCCAGCCTGGAGCCGG + Intergenic
1180152162 21:45954629-45954651 CTACCTGGGAAGCCTGGGGCAGG + Intergenic
1180224892 21:46386470-46386492 CTCCATTGGGAGCCTGTGCCTGG + Intronic
1180969870 22:19809710-19809732 CTCCATTGCACGCCCCGGGAGGG + Intronic
1181474685 22:23160967-23160989 CTCCATTGCCGACCTGGAGCCGG - Exonic
1181539382 22:23565384-23565406 CTCCATAGGAGGCCTGGGGAGGG + Intergenic
1183737420 22:39651548-39651570 CTCCCCTGCAGGCCTGGGTCAGG - Intronic
1185042416 22:48511953-48511975 CACCATTGCTAGGCTGAGGCCGG + Intronic
1185082764 22:48718830-48718852 CTGCAGGGCAAGCCTGGTGCAGG - Intronic
950890544 3:16400372-16400394 CAACACTGCCAGCCTGGGGCAGG + Intronic
951767310 3:26214707-26214729 CTACACTGCAGCCCTGGGGCAGG + Intergenic
953571538 3:44075623-44075645 CTCCACTGCATGCCAGGGCCAGG + Intergenic
953741353 3:45541818-45541840 CGGCATTGCAGGCCTGGCGCTGG + Exonic
954904227 3:54046030-54046052 GTCCTTTGCAAGCCTGTGCCTGG - Intergenic
959048128 3:101497432-101497454 GTTGATTCCAAGCCTGGGGCAGG + Intronic
959403393 3:105930976-105930998 CTCCATGCCAACCCTGGGGAAGG - Intergenic
959476898 3:106822352-106822374 CTCCTGTGCAAGCCTGTGGCTGG - Intergenic
959739131 3:109695606-109695628 CCCAGTTGCAAGCCTGGGGTGGG - Intergenic
959948289 3:112150054-112150076 TCCCATTGCAAGTCTGGGGTAGG - Intronic
961015912 3:123468063-123468085 CTCCATTGCACCCCTGCAGCAGG - Intergenic
962345168 3:134613392-134613414 CTCCTTTCCAGGGCTGGGGCAGG - Intronic
966851669 3:184168647-184168669 CTCTCTTGGAAGGCTGGGGCTGG + Intronic
966927594 3:184655580-184655602 CTCCATGGCAACCCTGGTGCTGG - Intronic
971611522 4:28731808-28731830 CGCTGTTGCAAGCCTGGGGCTGG - Intergenic
974020693 4:56689577-56689599 CTCCATTGCAAGGCAGTTGCAGG + Intergenic
974562569 4:63541011-63541033 CCCAACTGCAAGCCTGGGGTGGG + Intergenic
976130954 4:81883478-81883500 CTCCATTGATATCCTGGGGAAGG - Intronic
978681958 4:111391928-111391950 CTCCATTAAAAGCATGAGGCTGG + Intergenic
979615614 4:122739382-122739404 CTCCTTTTCATGCCTGTGGCTGG + Intronic
979962379 4:127036423-127036445 CTCCATCACAGGCCTGGGGCAGG + Intergenic
981235469 4:142410261-142410283 CTCTCGTGAAAGCCTGGGGCAGG - Intronic
981585698 4:146299968-146299990 CTCCATTGCACGCATGGAGTAGG + Intronic
984171856 4:176368813-176368835 CTCCATCGCAGGCCTGGGGTGGG - Intergenic
985665321 5:1179098-1179120 CTCCACTTCATGCCTGGGGACGG + Intergenic
986213088 5:5692352-5692374 CCCCATTTGAAGTCTGGGGCAGG + Intergenic
986399049 5:7361636-7361658 CTAGATTGTAAGCCTGGAGCTGG + Intergenic
988069420 5:26267361-26267383 CCTCATGGCAAGCCTGGGGCAGG - Intergenic
992349793 5:75916844-75916866 CCCCAGTGCCAGCCTTGGGCAGG + Intergenic
995743849 5:115383147-115383169 CTCCATGGCAGGCCAGAGGCAGG + Intergenic
997402655 5:133613963-133613985 CTCCATGGCAGGACTGGGGAAGG + Intergenic
998415385 5:141942345-141942367 CTGCATTGCACTCCTGGTGCTGG + Intergenic
1000410124 5:160929142-160929164 ACCAATTGCCAGCCTGGGGCAGG - Intergenic
1001677100 5:173528133-173528155 CTCCAGTACAAGCCTGTGGATGG + Intergenic
1002022355 5:176371952-176371974 CTTCATTGCCAGACTGGGCCTGG + Exonic
1002169276 5:177366349-177366371 CTTCACTGTAAGCCTGGGGTAGG + Exonic
1002797780 6:488989-489011 CTCCACTGGAAAGCTGGGGCAGG + Exonic
1003854815 6:10262555-10262577 CTCCTTTGGAAGGCTGAGGCAGG + Intergenic
1005207375 6:23420465-23420487 CCCCACTGCATGCCTGGGGCAGG + Intergenic
1006809845 6:36812856-36812878 CTCCAAGGCAAGCTTGGGGTAGG - Intronic
1007848222 6:44778775-44778797 CTGCTTTGCAATGCTGGGGCTGG - Intergenic
1010948370 6:82005490-82005512 TTCCATTGCAAGACTGGAACAGG + Intergenic
1011311252 6:85981876-85981898 ACCTGTTGCAAGCCTGGGGCAGG - Intergenic
1014081083 6:117286660-117286682 CTCAATTAGAAGCCTGGCGCAGG + Intergenic
1015795004 6:137002588-137002610 CTCCAGTCCAGGGCTGGGGCTGG + Intronic
1016175711 6:141075530-141075552 CCCTATTGCCAGCCTAGGGCAGG - Intergenic
1017731741 6:157323344-157323366 CTCCAGAGCAAGCCAGGGTCCGG + Intronic
1019380304 7:718219-718241 CCCCAGTGAAGGCCTGGGGCCGG - Intronic
1019699783 7:2469031-2469053 CTCCTTTACCAGCATGGGGCAGG - Intergenic
1019918745 7:4149784-4149806 CCCCATTGCCAGCCTTGGGAGGG - Intronic
1021257696 7:18413775-18413797 CATCATTGCAAGACTGAGGCTGG + Intronic
1024658551 7:51472648-51472670 CTTGATTGCAAGCCTAGGGAAGG + Intergenic
1024915204 7:54491663-54491685 GTGCTTTGCACGCCTGGGGCAGG + Intergenic
1025182426 7:56830206-56830228 GGCCATTGCAAGGCAGGGGCTGG + Intergenic
1025227804 7:57179483-57179505 CTAACTTGCAAGGCTGGGGCAGG + Intergenic
1025650942 7:63468339-63468361 CTGCTTTGCAGGCCTGAGGCAGG + Intergenic
1025730079 7:64100823-64100845 CTAACTTGCAAGCCTGGGGCGGG - Intronic
1025929250 7:65981577-65981599 CTAAATTGCAAGGCTGGGGCGGG + Intronic
1028868293 7:95737898-95737920 CCTAATTGCAAGCCTGGGACAGG + Intergenic
1029088158 7:98027590-98027612 CTGGATTGCAAATCTGGGGCAGG - Intergenic
1029524920 7:101088536-101088558 CTCCATCTCCAGCCTGGGGCTGG - Exonic
1031823221 7:126530483-126530505 CTCCTTTGCAAGGCTGAGTCTGG - Intronic
1032324915 7:130918480-130918502 CTCCAATTCAAACCTGGGTCAGG - Intergenic
1033117169 7:138635482-138635504 TTCCTTTGGAAGGCTGGGGCAGG - Intronic
1034424690 7:151008334-151008356 CTGCATTTCAAGCCTGGGACTGG + Intronic
1039771286 8:40689329-40689351 CTCCAGTGAATGGCTGGGGCCGG + Intronic
1039913807 8:41844970-41844992 CCGCGTTGCAATCCTGGGGCTGG - Intronic
1040878149 8:52174838-52174860 CTCCAGTGAAAGCCTGGGAGGGG - Intronic
1041632945 8:60108652-60108674 CAGCAGAGCAAGCCTGGGGCAGG + Intergenic
1041649033 8:60282868-60282890 CATCTTTGCAAGCCTGGGACTGG + Intergenic
1041774444 8:61508944-61508966 CTCCATTGAAAGCCCTGGGATGG + Intronic
1042109598 8:65366985-65367007 CCCTATTGCAGGCCTGGGGCCGG + Intergenic
1042848120 8:73188361-73188383 CTACAATGCAAGGCTGAGGCAGG + Intergenic
1043034282 8:75177569-75177591 CCCCATTGCCAGCCTGAGGCAGG + Intergenic
1046709703 8:117496539-117496561 CCCCATCACAAGCCTGGGGTGGG - Intergenic
1049387147 8:142348662-142348684 CGCCCTTGGCAGCCTGGGGCGGG - Intronic
1049696402 8:143986221-143986243 CGCCATTGCAACCCTGGGACGGG + Exonic
1050294829 9:4195086-4195108 CCCAACTGCAAGCCAGGGGCAGG + Intronic
1055905749 9:81292080-81292102 CTCCAGTACCAGCCTGGAGCTGG - Intergenic
1057587523 9:96342955-96342977 CGTCATTGCTGGCCTGGGGCTGG - Intronic
1060746070 9:126131729-126131751 CTCCAATGCAAGCCGCAGGCTGG - Intergenic
1061484385 9:130912944-130912966 CCCCAAAACAAGCCTGGGGCAGG + Intronic
1062070969 9:134554809-134554831 TTGCCTTGCAAGCCTGGGGGTGG - Intergenic
1062506753 9:136881609-136881631 GTCCAGGGCAAGCCTGGGGCTGG - Intronic
1187414485 X:19081368-19081390 CTGCACTGCAGGGCTGGGGCAGG + Intronic
1191652462 X:63555002-63555024 GTTAATTTCAAGCCTGGGGCAGG - Intergenic
1192201519 X:69069329-69069351 CTCCTTTGCAGGCCTGGATCAGG + Intergenic
1195415886 X:104619060-104619082 CTCCATTGCAAGCCTCAGGCAGG - Intronic
1195416115 X:104621353-104621375 CCCCATTGCAAGCCTGGGGTAGG + Intronic
1199511894 X:148631674-148631696 CTCCATTGAAAGGCAGGGGGAGG + Intronic
1199536137 X:148905470-148905492 CTCCACTGTGAGCCTGTGGCTGG + Intronic
1200916228 Y:8573571-8573593 TTCCAATGCAAGCATGGGGACGG + Intergenic