ID: 925956140

View in Genome Browser
Species Human (GRCh38)
Location 2:8967042-8967064
Sequence CTGAATTGACTTGAGATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 237}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925956140 Original CRISPR CTGAATTGACTTGAGATGTA TGG (reversed) Intronic
906576244 1:46892939-46892961 ATGAATTGACAACAGATGTATGG - Intergenic
906595677 1:47074647-47074669 ATGAATTGACAACAGATGTATGG + Intronic
906948388 1:50315185-50315207 CTGAATTGATTTGACCTGTAGGG + Intergenic
907069902 1:51524983-51525005 CTGACTTGCCTTGTGATTTAGGG - Intergenic
908446721 1:64204860-64204882 CTGCATTCACTGGAGATGTTAGG + Intronic
909657121 1:78044650-78044672 CTGAATTGATGTGAGAGGTGAGG + Intronic
911400305 1:97366549-97366571 ATGATTTGACTTGATAAGTATGG - Intronic
912067577 1:105763419-105763441 CAGAATTGAATTGAACTGTAGGG + Intergenic
912735524 1:112146565-112146587 ATGAATTGACTTGAGACAAAGGG + Intergenic
916366701 1:164036671-164036693 CTAAATTCACTTGATGTGTATGG - Intergenic
917574008 1:176300527-176300549 TTCAATTGATTTGAGATGAAAGG + Intergenic
919541810 1:198856625-198856647 ATGAAATGAATTGAGATTTATGG + Intergenic
920802349 1:209201421-209201443 CTGACTTGAGTTGGGATGAAGGG - Intergenic
921120888 1:212136311-212136333 CTGAGTTCACTGTAGATGTATGG - Intergenic
923965471 1:239134128-239134150 CTGAATTGTCTTCAGATACACGG - Intergenic
923992437 1:239454095-239454117 CAGAATTGAGTTGAATTGTAGGG - Intronic
924486482 1:244488409-244488431 CTGGATTGAATTGACATTTAAGG - Intronic
924583566 1:245342526-245342548 CAGAATTGACTTCAGAAGAAAGG - Intronic
1065708636 10:28494455-28494477 GTGAACTGACTTGGGAAGTATGG - Intergenic
1066742186 10:38527822-38527844 CTGAAATGACATGATTTGTATGG + Intergenic
1066742851 10:38576204-38576226 CTGAATTGACTTGAAAGGAATGG + Intergenic
1066969370 10:42300636-42300658 CGGAATTGACTTGAGCGGAATGG - Intergenic
1068103557 10:52585908-52585930 CTGAATTTACTGCAGATGTATGG + Intergenic
1070673590 10:78396226-78396248 ATGAATTGACTTTAGATGTGAGG + Intergenic
1071733043 10:88268248-88268270 CTAAATGGTCTTGAGAGGTATGG - Intergenic
1072760012 10:98048919-98048941 CTGATTTGCTGTGAGATGTAGGG - Intergenic
1073500533 10:103932790-103932812 CTGTATTGACTTCAAAAGTAGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075354150 10:121755952-121755974 CTGAAATGAGTTGAGATGTTGGG - Intronic
1076406238 10:130214095-130214117 CTGAATTGACTCCAAATGGAAGG + Intergenic
1079576233 11:22006290-22006312 TTGAATTCACTTGAGAAGTTAGG - Intergenic
1079972561 11:27054266-27054288 CTTCATTGCCTTGAGATGAAGGG - Intronic
1080982297 11:37423351-37423373 CTGAAATGAGTTGAGACTTAGGG - Intergenic
1081114035 11:39175385-39175407 CTGATTTCACTTGAGATAAAAGG + Intergenic
1081422578 11:42888583-42888605 ATGAATTCACTGTAGATGTATGG - Intergenic
1082638312 11:55623886-55623908 GTAAATTGCTTTGAGATGTATGG + Intergenic
1084279445 11:68077808-68077830 CTGAACTGACCTGAGATCTGAGG + Intronic
1085828415 11:79873128-79873150 CTGAATTGAATTAAATTGTAGGG - Intergenic
1085907469 11:80781621-80781643 CTGAATTAAGTTGTGTTGTAAGG - Intergenic
1085976349 11:81660154-81660176 CTGAGTAGATTTCAGATGTATGG - Intergenic
1087125920 11:94625711-94625733 CTGAATTGAGTTGAGACTTTGGG - Intergenic
1087255457 11:95948066-95948088 CTGAAATGAGTTGAGATTTTGGG - Intergenic
1088434950 11:109802139-109802161 CAGAATTGAATTGAACTGTAGGG - Intergenic
1091040485 11:132275334-132275356 ATCAATTGACTTTATATGTATGG + Intronic
1093412629 12:18884642-18884664 CTGAATTGAGTGGAGATGATGGG + Intergenic
1093451144 12:19316185-19316207 CTAAATTGACATGAGATCAAAGG + Intronic
1093531542 12:20170668-20170690 ATGAATTCACTGTAGATGTATGG + Intergenic
1094223967 12:28025428-28025450 ATGGCCTGACTTGAGATGTAAGG + Intergenic
1095438066 12:42213438-42213460 AAGAATTGACTTGAAAAGTAAGG - Intronic
1099547464 12:84002834-84002856 ATGAATTCACTGTAGATGTATGG + Intergenic
1100113422 12:91272930-91272952 CTGAATTTACATGTGATGAAAGG + Intergenic
1100123031 12:91391335-91391357 ATGAATTCACTATAGATGTATGG + Intergenic
1101057219 12:100930479-100930501 ATGAATTTACTATAGATGTATGG + Intronic
1101073123 12:101097152-101097174 CTGAAATGCCTCCAGATGTAAGG - Intronic
1101128397 12:101663298-101663320 CTGAATTTCATTAAGATGTAGGG + Intronic
1102708545 12:114905020-114905042 CTGAATAGTCATGAGATGCATGG - Intergenic
1104517206 12:129438801-129438823 CTTAATTGAATGGTGATGTAGGG - Intronic
1108602590 13:52007604-52007626 CGGAATTGAATTGAATTGTAGGG - Intronic
1108614515 13:52118587-52118609 CAGAATTGTATTCAGATGTATGG + Intronic
1112069641 13:95835130-95835152 CTGAATTGAGATGTGCTGTAAGG - Intronic
1114917687 14:27288394-27288416 CTGAAATGAGTTGAGATTTTAGG - Intergenic
1118676590 14:68192090-68192112 CTGAATTGAAGAGAGATGTCTGG - Intronic
1120157084 14:81105325-81105347 CTGTCTTGACTTCAGATGGAAGG + Intronic
1120580010 14:86235361-86235383 ATGAATTCACTGCAGATGTATGG - Intergenic
1121377215 14:93423557-93423579 ATGAATTCACTGTAGATGTATGG - Intronic
1123128227 14:105965061-105965083 CTGAAATGAGTTAAGATGTTGGG + Intergenic
1123408752 15:20041217-20041239 CTGAAATGAGTTAAGATGTTGGG + Intergenic
1123518083 15:21047927-21047949 CTGAAATGAGTTAAGATGTTGGG + Intergenic
1126695297 15:51320941-51320963 CTGAATTGAGATGTGCTGTAAGG - Intronic
1127133101 15:55888793-55888815 ATGAATTCACTGTAGATGTATGG - Intronic
1127431764 15:58917232-58917254 CTTAACTGACTTGACATATATGG + Intronic
1128541958 15:68542334-68542356 CTGTAATTACTTGAAATGTAGGG - Intergenic
1128966470 15:72063091-72063113 ATGAATTCACTATAGATGTATGG - Intronic
1131452551 15:92557288-92557310 CTCAATTGACTGTAGATGTGTGG - Intergenic
1133089124 16:3389931-3389953 CTGAAAGGACTTGAGAGGGAGGG - Intronic
1134605130 16:15564462-15564484 CTTATTTCACTTGAAATGTATGG - Intronic
1134651878 16:15915844-15915866 ATCAATTGACTATAGATGTATGG + Intergenic
1135683200 16:24476335-24476357 CTGAGATGACCAGAGATGTAAGG - Intergenic
1140297448 16:73722931-73722953 CTGAGATGACTGGAAATGTAAGG - Intergenic
1141259553 16:82440280-82440302 CTGAATTAAAATGAGAAGTATGG - Intergenic
1151513962 17:74580294-74580316 CTGAGTTTACTGGAGGTGTAGGG - Intronic
1151560871 17:74868914-74868936 CTGGATGGATTTGAGATGTCTGG - Intronic
1153059632 18:981985-982007 GTCAATGGACTGGAGATGTAGGG - Intergenic
1153715278 18:7840936-7840958 CCAAATTGACCTGAGATGAAAGG + Intronic
1155803119 18:30134043-30134065 CTGAATCGACTTGAGATGCTGGG - Intergenic
1159282819 18:66309830-66309852 CTGAAATGAGTTAAGATTTAGGG - Intergenic
1159731547 18:72034031-72034053 CTGAAATGAGTTAAGATGTTGGG - Intergenic
1159827554 18:73233008-73233030 CTTAATTGAATTGCCATGTAAGG - Intronic
1165809046 19:38599704-38599726 CAAAATTGACTTGAGAGGTGAGG + Intronic
1167858369 19:52261627-52261649 CAGAAATGATTTCAGATGTATGG - Intergenic
1168449558 19:56454523-56454545 ATGAATTCACTGTAGATGTATGG - Intronic
925956140 2:8967042-8967064 CTGAATTGACTTGAGATGTATGG - Intronic
926590324 2:14733795-14733817 CTGAATTGAAGTGAGTTGTTGGG - Intergenic
928932890 2:36643544-36643566 ATGAGTTGACTGTAGATGTATGG - Intronic
929226966 2:39521185-39521207 CTGAAATGAGTTAAGATTTAGGG - Intergenic
929824176 2:45297142-45297164 CTGAATTGAGATGTGAGGTAAGG + Intergenic
930301891 2:49627074-49627096 CTACATTGACTTGAGATGTCTGG - Intergenic
930441507 2:51413720-51413742 CTGTGTTGACTTCAGATGGAGGG + Intergenic
931373619 2:61687894-61687916 CAGAGTTGACTATAGATGTAAGG - Intergenic
936472428 2:112811145-112811167 CTGCAGTGACCTGAGATGTCAGG + Intergenic
936743496 2:115544809-115544831 GTGAATTGATTTCAAATGTAGGG + Intronic
937337879 2:121072853-121072875 CGGAATTGACGTGGGCTGTACGG - Intergenic
938850123 2:135251360-135251382 CTGAAATGAGTTAAGATGTTGGG + Intronic
940815840 2:158296367-158296389 ATCAACTGACTTGAGATGTGTGG + Intronic
941319803 2:164040804-164040826 CTGAAATGAGTTGAGATTTTGGG - Intergenic
942199307 2:173554759-173554781 CAGAATTGAACTGAGTTGTAAGG + Intergenic
943347757 2:186760083-186760105 ATGAATTCACTGTAGATGTATGG + Intronic
943826678 2:192403522-192403544 CTGAATTAACTAGAAATCTAAGG - Intergenic
944751192 2:202711840-202711862 CTGAGTTCACTGTAGATGTATGG + Intronic
945378389 2:209108292-209108314 ATGAATTCACTGTAGATGTATGG - Intergenic
947332966 2:229049480-229049502 CTGAATTTATTTGAAATGCAAGG + Intronic
947888654 2:233596272-233596294 CTGAAATGAGTTAAGATTTAGGG + Intergenic
1168766151 20:382475-382497 CAGAACAGCCTTGAGATGTAAGG + Intronic
1171920796 20:31097030-31097052 TTGAATTGACTTGAAAGGTATGG + Intergenic
1171921775 20:31104677-31104699 TGGAATTGACTTGAAATGAATGG + Intergenic
1171929297 20:31215190-31215212 TTGAATTGACTTGAAAGGTATGG + Intergenic
1171930276 20:31222822-31222844 TGGAATTGACTTGAAATGAATGG + Intergenic
1176745970 21:10652938-10652960 CTGAATTGACTTGAATCGAATGG - Intergenic
1176844454 21:13865787-13865809 CTGGAATGAATTGAGATTTAGGG - Intergenic
1177517760 21:22177132-22177154 CTGAAATGAGTTAAGATGTGCGG + Intergenic
1177652139 21:23970679-23970701 ATGAATTCACTGTAGATGTATGG + Intergenic
1177873638 21:26603991-26604013 ATGAGTTCACTTTAGATGTATGG + Intergenic
1178102428 21:29284074-29284096 TTGAATTGAATTGAAACGTAAGG - Intronic
1178626560 21:34223418-34223440 GTGAAATGAATTTAGATGTATGG - Intergenic
1179217718 21:39381497-39381519 CTGCATTGTCCTGAGATATAGGG + Intronic
1180033445 21:45228581-45228603 CTGTGTTGGCTTCAGATGTAGGG + Intergenic
1180624575 22:17185708-17185730 CTAAATTGACTCGAAATGTCAGG + Intronic
1182725227 22:32440077-32440099 ATGAATGGATTGGAGATGTAGGG - Intronic
949235408 3:1802943-1802965 CTGAGTTCACTGTAGATGTATGG + Intergenic
950813902 3:15678272-15678294 CAGAATTGACTTGAGCATTATGG + Exonic
952665245 3:35896150-35896172 CTGTATAGATTTGAGTTGTATGG + Intergenic
953096455 3:39781364-39781386 CTCTCTTGACTTGAGATGAAGGG + Intergenic
957175261 3:76800064-76800086 ATGAGTTCACTTTAGATGTATGG - Intronic
957204148 3:77173021-77173043 CTGAATGGAGTGGAGATGTCAGG + Intronic
957392241 3:79591409-79591431 CTGACTTTACTTGAGATATTTGG + Intronic
957562177 3:81836174-81836196 CTTAATGGAGTTGAGATTTAGGG + Intergenic
959447350 3:106456769-106456791 CTGAAATGACTGGAGATGATTGG - Intergenic
959818275 3:110702146-110702168 ATGAATTCACTGTAGATGTATGG + Intergenic
961174660 3:124824282-124824304 CTGAATTGACTAGATATGTGTGG - Intronic
963529205 3:146452169-146452191 CAGAATTGAACTGAGTTGTAGGG + Intronic
965146485 3:164912268-164912290 CTGAATTGATTTGAGACTTAGGG - Intergenic
965348940 3:167589234-167589256 ATGAATTCACTGTAGATGTATGG + Intronic
966059084 3:175733632-175733654 CTGAAATGAGTTGAGATTTTGGG - Intronic
966626548 3:182022974-182022996 CTGAATTTGTTTGAGCTGTATGG - Intergenic
967513562 3:190340694-190340716 CTGAAATGAGTTAAGATGTTGGG - Intronic
968018677 3:195363810-195363832 ATGAGTTCACTTTAGATGTATGG - Intronic
971307977 4:25500464-25500486 ATGAATTGTCTTGTGATGTCTGG + Intergenic
973917038 4:55644786-55644808 ATGAGTTGACTTTAGATATATGG + Intergenic
975575807 4:75861359-75861381 ATCAATTGACTATAGATGTATGG - Intronic
976722647 4:88184890-88184912 ATGAATTCACTGTAGATGTATGG - Intronic
976762308 4:88562798-88562820 ATGAATTCACTGTAGATGTATGG + Intronic
977266454 4:94861965-94861987 CTTATTTGACTTTAGTTGTAAGG + Intronic
978236183 4:106463737-106463759 CTGAATTCACTTGAGGAGCAAGG + Intergenic
979412007 4:120391356-120391378 CTGAAATGACATGACATTTAGGG + Intergenic
980310385 4:131121624-131121646 ATAAATTGACTGTAGATGTATGG + Intergenic
980823929 4:138051964-138051986 TTGAGTGGACTTGAAATGTATGG - Intergenic
981837346 4:149070174-149070196 ATGAATTCACTGTAGATGTATGG - Intergenic
982417218 4:155149432-155149454 ATCAATTGACTTGAGGTCTAAGG - Intergenic
983599064 4:169503563-169503585 ATGAATTCACTATAGATGTATGG - Intronic
983870573 4:172820703-172820725 TTGACTTGACTTGAGAAGCAGGG - Intronic
984271014 4:177548673-177548695 CTGAATTGAATTGAATTGGAGGG + Intergenic
985040078 4:185881549-185881571 CTGAATTCTCTAGAGATTTATGG - Intronic
985190912 4:187371705-187371727 CTTAAGTGACATGAGATGGATGG + Intergenic
985947166 5:3194837-3194859 CTGAATTGTCTTAAGAGGGAAGG - Intergenic
987015948 5:13819728-13819750 CTTAGATGACTTTAGATGTAAGG + Intronic
989986932 5:50711749-50711771 CTGAATTGACTTTAAACATAAGG - Intronic
990059655 5:51631515-51631537 CAGAATTGTTTTGAAATGTATGG + Intergenic
990095608 5:52108449-52108471 CTGATTTGACTGGTGATGTATGG - Intergenic
991093081 5:62711552-62711574 CTGTATTGACTTGTGATTTGTGG + Intergenic
991150977 5:63369534-63369556 ATGAATTGAGTAAAGATGTATGG - Intergenic
992008396 5:72501952-72501974 CTGAATTGACTGGAACTATATGG - Intronic
994029203 5:95121829-95121851 ATGAATTCACTATAGATGTACGG - Intronic
994785310 5:104152631-104152653 CTAAATTGAATGGAGAAGTAAGG + Intergenic
995016978 5:107321021-107321043 CTGGATTGACTTGACATTTTTGG - Intergenic
995025197 5:107412272-107412294 TTGAACTGACTTGGAATGTACGG + Intronic
995572736 5:113497749-113497771 CTGAGTTCACTGTAGATGTATGG + Intergenic
996259733 5:121451592-121451614 ATGAGTTCACTGGAGATGTATGG - Intergenic
997330283 5:133055206-133055228 CAGAAATCACTTGAAATGTATGG - Intronic
997901448 5:137769384-137769406 ATGAATTCACTGTAGATGTATGG - Intergenic
999379964 5:151114052-151114074 CTGTATTGACATGAGGTGTTTGG + Intronic
1002411916 5:179086744-179086766 CTGATTTGCCTTGAAATGTGAGG + Intergenic
1002766446 6:243682-243704 ATGAGTTCACTTTAGATGTATGG - Intergenic
1003485665 6:6576298-6576320 CTGAAATGAACTGAGATGTGTGG - Intergenic
1004203217 6:13569475-13569497 CTCATTTGTCTTGAGGTGTAGGG - Intergenic
1008319947 6:50098799-50098821 AAGAATTGACTTGAGAAGCAAGG + Intergenic
1008750245 6:54724474-54724496 CTGAGTAGACTTGAGATTTTTGG + Intergenic
1009602193 6:65815909-65815931 CTGAATAGACTACAGATATAAGG + Intergenic
1010132967 6:72517057-72517079 GTTATTTGACTTGAGATATAAGG + Intergenic
1010488352 6:76443941-76443963 ATGAATTGACTGTAGTTGTATGG + Intergenic
1011241686 6:85278212-85278234 CTGACTTAACTTGAGAAATAAGG - Intergenic
1012159961 6:95872360-95872382 CTGACTTGACTTAGGATTTAGGG + Intergenic
1013687731 6:112604668-112604690 CTGATTTCACTTTAAATGTATGG - Intergenic
1014229482 6:118887326-118887348 ATGAATTGACCTTAAATGTATGG - Intronic
1014235517 6:118949938-118949960 ATGAGTTCACTGGAGATGTATGG - Intergenic
1014692887 6:124583836-124583858 ATGAATTCACTGTAGATGTATGG - Intronic
1017839021 6:158206166-158206188 CTGAAATGACTTAAGGCGTAGGG - Intergenic
1021507652 7:21403274-21403296 CAGAAGTGAATTGAGATATAGGG - Intergenic
1021999528 7:26212763-26212785 CTTATTTCACTTGAAATGTATGG - Exonic
1022297829 7:29073185-29073207 CAGAATTAACATGAGATGAAAGG - Intronic
1023716584 7:43050870-43050892 ATGAATTCACTGTAGATGTATGG - Intergenic
1024158200 7:46647700-46647722 CTGAAATGAGTTAAGATGTTGGG - Intergenic
1024956898 7:54931813-54931835 ATGAGTTCACTTGAGATGTGTGG - Intergenic
1028043295 7:86085982-86086004 CTGAATTGGCCAGAGATGAATGG + Intergenic
1028386262 7:90256924-90256946 TTTAATTGACTTAAGATGTTTGG + Intronic
1030819100 7:114075682-114075704 CTGAATCTTCTTGAGATGTCTGG - Intronic
1031260386 7:119511075-119511097 ATGAATTCACTGCAGATGTATGG - Intergenic
1033070258 7:138195637-138195659 CTAAATTGACTTGAAGTCTAGGG - Intergenic
1033877132 7:145835602-145835624 ATGAGTTCACTTTAGATGTATGG + Intergenic
1035872982 8:3155980-3156002 CTAAATTTATTTGAGATGTGGGG + Intronic
1039097866 8:33906029-33906051 CTGAATTGATTTGAGTTCCATGG - Intergenic
1043244850 8:77984765-77984787 CTGAATTGAAATGAGATGGGTGG + Intergenic
1043287504 8:78552056-78552078 CTGAATTGAAGGGAGATGTCTGG + Intronic
1043829874 8:84974834-84974856 ATGAATTCACTATAGATGTATGG - Intergenic
1044407738 8:91848896-91848918 ATGAATTCACTGTAGATGTATGG - Intergenic
1045590443 8:103588602-103588624 ATGAATTCACTGTAGATGTATGG - Intronic
1045824736 8:106383775-106383797 CTGACTTGGCTTACGATGTATGG - Intronic
1047387281 8:124421771-124421793 GTAAATTGTATTGAGATGTAGGG + Intergenic
1048388749 8:133939657-133939679 CTGAATTTAATTGACATTTATGG + Intergenic
1050574990 9:6985563-6985585 CTGAATTGAGTTTTGATGAATGG + Intronic
1052122153 9:24730987-24731009 GTGACTTGACTTCAGATGGACGG - Intergenic
1052304240 9:26987412-26987434 ATGAAATGACATGAGATGAAAGG + Intronic
1052399187 9:27979167-27979189 CTGAATTGAGATGACATCTAAGG + Intronic
1053879131 9:42574765-42574787 CTGAAATGAGTTAAGATGTTGGG - Intergenic
1053893534 9:42719589-42719611 CTGAAATGAGTTTAGATGTTGGG + Intergenic
1054232559 9:62526932-62526954 CTGAAATGAGTTAAGATGTTGGG + Intergenic
1057832366 9:98417163-98417185 CTGAGTTGAGTTGAGTTGAATGG + Intronic
1058649313 9:107159991-107160013 CTGAAATGAGTTAAGATGTTGGG + Intergenic
1058663822 9:107290437-107290459 CTGAATTTTCTTGAGAAGCAGGG - Intronic
1061245931 9:129401359-129401381 CTGAATTGACTTGGAATGTCCGG + Intergenic
1203352729 Un_KI270442v1:94601-94623 TGGAATCAACTTGAGATGTATGG + Intergenic
1186821207 X:13290091-13290113 CTGAATGAACTTGAAATGTTTGG + Intergenic
1187323500 X:18264289-18264311 CAGAATTGACTGGAGATGACAGG - Intronic
1187542556 X:20212171-20212193 CTTATTTGACATGAGATGAAAGG - Intronic
1188426654 X:30055359-30055381 ATGAATTCACTGTAGATGTACGG + Intergenic
1189025244 X:37387807-37387829 CTGAAATGACTTAAGATTTTGGG - Intronic
1189109698 X:38275922-38275944 CTGGATTAACTTCAGAAGTATGG - Intronic
1189579559 X:42391431-42391453 ATGAATTGACTTGAGAAGATTGG + Intergenic
1190371420 X:49745770-49745792 ATGAATTCACTGTAGATGTATGG - Intergenic
1191080178 X:56502659-56502681 ATGAACTCACTTTAGATGTATGG - Intergenic
1193439078 X:81516243-81516265 CTGAAATGAGTTGAGATTTTGGG + Intergenic
1194923876 X:99799923-99799945 CTCAATTCATTTAAGATGTAAGG - Intergenic
1195096423 X:101505461-101505483 CAGTATTGATTTGAGAGGTATGG + Intronic
1195300420 X:103524682-103524704 CTGAAGTGCCTTGGGATGTGGGG - Intergenic
1195595854 X:106688601-106688623 ATGAGTTCACTTTAGATGTATGG - Intergenic
1195823858 X:108975958-108975980 ATGAATTCACTGTAGATGTATGG - Intergenic
1196750855 X:119116166-119116188 CTAAAATAACTTGAGATGTGGGG - Intronic
1197548605 X:127859884-127859906 GTGAATTGCCTTGGGCTGTATGG + Intergenic
1198129018 X:133675563-133675585 CTGAACTGACCTGAGATAAAAGG + Intronic
1198696822 X:139349813-139349835 ATGAGTTCACTTTAGATGTATGG + Intergenic
1199203226 X:145117986-145118008 CTGAGTTCACTGTAGATGTATGG - Intergenic
1201635086 Y:16113795-16113817 TTGAATTGGCTTGAGATTTGAGG - Intergenic