ID: 925957686

View in Genome Browser
Species Human (GRCh38)
Location 2:8984224-8984246
Sequence AGGCCAGGGGTTGGGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1334
Summary {0: 1, 1: 0, 2: 16, 3: 131, 4: 1186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925957676_925957686 22 Left 925957676 2:8984179-8984201 CCACTTACACGAAGTATCTAGAA 0: 1
1: 7
2: 64
3: 322
4: 1103
Right 925957686 2:8984224-8984246 AGGCCAGGGGTTGGGGTGAGGGG 0: 1
1: 0
2: 16
3: 131
4: 1186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925957686 Original CRISPR AGGCCAGGGGTTGGGGTGAG GGG Intronic
900151317 1:1180424-1180446 AGGCAAGGGGTTGGGGATGGCGG - Intronic
900192886 1:1358879-1358901 AGGCCAGAGGTGGGGCGGAGGGG - Intronic
900346396 1:2212513-2212535 GGGCCGGGGGTGGGGGTGGGGGG - Intronic
900388789 1:2424371-2424393 AGGCCAGGGTTTGGGGAATGGGG - Intergenic
900423152 1:2564415-2564437 AGGAGAGGAGTTGGGGTGGGTGG - Intronic
900673134 1:3868274-3868296 AGGTCACGGGTTGGGGAGCGGGG + Intronic
900701806 1:4053287-4053309 AGTCCACGGGGTGGGGAGAGAGG - Intergenic
901786161 1:11626219-11626241 AGCCCAAGGGGTGGGGTGGGCGG + Intergenic
901897108 1:12323467-12323489 TGGCCAGGAATTGGGGTGGGGGG - Intronic
901945079 1:12695406-12695428 AGGGCAGTGGTAAGGGTGAGGGG - Intergenic
902250437 1:15151626-15151648 AGGCCTGGGGTGGGGGCGGGGGG - Intergenic
902288399 1:15421390-15421412 AGGCCAGGTGCTGGGGTGGGCGG - Intronic
902291272 1:15436871-15436893 AGGCCAGGCCTTGGGGCGAATGG + Intergenic
902544882 1:17183971-17183993 AAGTCAGGGGTTGAGGTGACAGG + Intergenic
902564066 1:17298461-17298483 AGGGCTGGGGTAGAGGTGAGGGG - Intergenic
902635886 1:17734981-17735003 AACCCAGGGGTTGGAGTGAATGG + Intergenic
902696030 1:18141491-18141513 AGGGCAGGGGGTTGGGGGAGAGG + Intronic
902710225 1:18234265-18234287 AGGCCAGGGGTTGGGGAAGGAGG - Intronic
903071848 1:20730622-20730644 AGGCCTGGAGTTGGGGTGGGGGG + Intronic
903225477 1:21892305-21892327 AGGCCAGGGGCTTGGGTGGGGGG - Intronic
903325099 1:22564726-22564748 AGGGCAGGGGTTGGGGTGTGGGG - Intronic
903328678 1:22585989-22586011 AGGCCAGGGATGGGGGTGCTGGG - Intronic
903611052 1:24613051-24613073 CTGCCAGGGGCTGGGGAGAGAGG - Intergenic
903800456 1:25963457-25963479 TGGCCAGGGGTTGGAGTGAAGGG + Intronic
903973796 1:27136491-27136513 AGGAGAGGGGTTAGGGTGACTGG - Intronic
904270077 1:29344107-29344129 AGGACGGGGGTCAGGGTGAGGGG - Intergenic
904425831 1:30422416-30422438 AGGCCAGGGACTGAGGAGAGAGG + Intergenic
904480162 1:30788348-30788370 ATCCCAGCGGTTGGAGTGAGGGG - Intergenic
904783193 1:32965777-32965799 ACTCCAGAGGTTGGGGTGGGAGG - Intergenic
904982385 1:34517498-34517520 GGGTCAGGGGTGAGGGTGAGGGG + Intergenic
905008563 1:34730962-34730984 TGGCCTGGGGTTGGGGAGATGGG - Intronic
905109512 1:35585044-35585066 AGGCCAGGGATGGGGGTGAGAGG + Intronic
905174705 1:36128112-36128134 GGGGCAGGGGTTGGGGGGAAAGG - Intergenic
905276413 1:36821495-36821517 AGGGCAGGGGTCGGGCTGATGGG + Intronic
905322787 1:37129658-37129680 AGGGAGGGGGTTGGGGTAAGGGG + Intergenic
905591897 1:39171432-39171454 TTGCCAGGGGTTGGGGAGAAGGG - Intronic
905649578 1:39647315-39647337 AGGACTGGGGTAGGGGTCAGGGG - Intergenic
905779158 1:40692278-40692300 AGGCGTGGGGTTGCGGCGAGAGG + Intronic
905851674 1:41279465-41279487 AGGACATGGTTGGGGGTGAGGGG + Intergenic
905946699 1:41907274-41907296 GGGACAGGGGTAGGGGAGAGGGG + Intronic
905976254 1:42175984-42176006 AGGGCAGGGGGTAGGGAGAGGGG + Intergenic
906153939 1:43603288-43603310 AGGCCAGGGGTTGTGGAAGGTGG - Intronic
906287197 1:44595215-44595237 AGGCCCGAGGTAGGGGTGGGAGG + Intronic
906394919 1:45454239-45454261 TTGCCAGGGGTTGGGGGGAATGG + Intronic
906518266 1:46452294-46452316 TGGCCATGGGTGGAGGTGAGGGG + Intergenic
906518817 1:46455580-46455602 GGGTCAGGGGTGGGGGTGGGTGG - Intergenic
906777867 1:48545965-48545987 AGGACAGGGATTGGGGTTAAAGG + Intronic
906940538 1:50251706-50251728 AAGCCAGGGGCTGGGCTGAAGGG - Intergenic
906942822 1:50271313-50271335 AGGGCAGGGGGTGGGGGGCGGGG - Intergenic
907161379 1:52372559-52372581 TGGCCAGGGTTAGGGGTTAGAGG - Intergenic
907170171 1:52455654-52455676 AGGGCAGGGGAGGGGGGGAGAGG + Intronic
907384574 1:54117734-54117756 AGGTCTGGGGGTGGGGTGGGCGG + Intergenic
907487349 1:54787067-54787089 AGGCCAGGGCTGGGGGTGAAGGG + Exonic
907906101 1:58784519-58784541 GGGCCAGGGGTGCGGGCGAGGGG + Intergenic
908909085 1:69051900-69051922 GGGCTAGGGTTTGGGGTGTGGGG - Intergenic
909243176 1:73240505-73240527 CTGCCAGGGGGTGGGGAGAGGGG + Intergenic
909445219 1:75742149-75742171 AGGCCTGGGGGTGGGGAGGGGGG - Intronic
909534701 1:76723546-76723568 AGTCAAGTGGTTGTGGTGAGTGG - Intergenic
910112004 1:83692958-83692980 GGGGCAGGGGTGGGGGTGAAAGG - Intergenic
910477651 1:87624023-87624045 AGGCCGGGGGGTGGGGAGGGGGG - Intergenic
910660717 1:89669262-89669284 TTGCCAGGGGCTGGGGGGAGGGG + Intronic
911130782 1:94385525-94385547 ATGGCAGGGGTTGGTGTCAGTGG - Intergenic
912194886 1:107385979-107386001 ATGCCAGGAGATGGGGAGAGGGG - Intronic
912471992 1:109912400-109912422 AAGCCAGGGCTAGGGGTGGGAGG + Intronic
912525638 1:110280822-110280844 AGACCAGGGGATGGTGTGGGAGG - Intronic
912620575 1:111152420-111152442 AGGAGAGAGGTTAGGGTGAGGGG - Intronic
912687657 1:111779695-111779717 TGGGCAGGGGTGGGGGTGGGGGG + Intronic
912762767 1:112383742-112383764 ATGCCAGGGGCTGAGGGGAGGGG - Intergenic
913470858 1:119184260-119184282 AGGCTAGGGGTTTGGGTGAATGG - Intergenic
914249912 1:145913138-145913160 TTGCCAGGGGTTGGGGAGTGAGG + Intronic
914328819 1:146647314-146647336 AAGCCAAGGGTTAGGGTGACAGG + Intergenic
914878671 1:151530810-151530832 AGGACAGGGGCTTGGGGGAGAGG + Intronic
914973500 1:152333958-152333980 GGCCAAGGGGTTGGGGGGAGAGG - Intergenic
915103689 1:153518745-153518767 TGGCCAGGGGCTGGAGAGAGGGG + Intergenic
915284096 1:154842034-154842056 AGCCCAGGGTAAGGGGTGAGGGG + Intronic
915309521 1:155000274-155000296 TGGTTAGGGGTTGGGGTAAGAGG + Intergenic
915455951 1:156040922-156040944 AGGCCAGGGGCTGGCAGGAGGGG - Intronic
915524017 1:156465257-156465279 AGGTCTGGGGTTGGGGGAAGAGG + Exonic
915530602 1:156500409-156500431 GGTCCAGGGGTTGGGGTGGAGGG - Intronic
915911455 1:159918196-159918218 TGGCTAAGGGGTGGGGTGAGGGG - Exonic
915978241 1:160404568-160404590 TTGCCAGGGGCTGGGGTAAGGGG - Intronic
916344398 1:163771526-163771548 AGGCAGGGGGTGGGGGTGAGGGG + Intergenic
916499041 1:165370657-165370679 AAGCCAGGTGTGGGGCTGAGAGG + Intergenic
916705312 1:167343148-167343170 AGGTCAGGGGTGGGGGTCAAGGG + Intronic
916705490 1:167345046-167345068 ATACCAGGGGTGAGGGTGAGGGG + Intronic
916725833 1:167522732-167522754 TTGCCAGGGGATGGGGAGAGTGG + Intergenic
916860168 1:168795098-168795120 GGGTCAGGTGCTGGGGTGAGAGG + Intergenic
917242019 1:172958805-172958827 GGGGGAGGGGGTGGGGTGAGGGG + Intergenic
917525083 1:175781343-175781365 AGGCCAGTGGCTGGAGTCAGAGG - Intergenic
917580990 1:176377583-176377605 AGGCTAGGGGTGAAGGTGAGAGG + Intergenic
918065767 1:181100659-181100681 AGGGCTGGGGTGGGGGTGAGGGG - Intergenic
919269796 1:195325444-195325466 AAGCCAGGAGTCGGGGTGAGCGG - Intergenic
919471538 1:197985342-197985364 CGGCCAGGGGCTGGGTGGAGTGG + Intergenic
919567494 1:199207108-199207130 AGGCCGGGGCGTGGGGTGGGGGG + Intergenic
919589726 1:199485981-199486003 TGTCTAGGGGTTGGGGTAAGGGG - Intergenic
919770909 1:201157970-201157992 AGGCCCTTGGTTGGGGAGAGTGG + Intronic
919788259 1:201274129-201274151 GGGCCAGGGGTTGGGGAGGGTGG - Intergenic
919831311 1:201542041-201542063 AGAGCAGGGGTTGGGAGGAGTGG - Intergenic
919858944 1:201725562-201725584 AGCCCAGGAGTTGGGGCGGGGGG + Intronic
919982935 1:202653626-202653648 AGGCCAGTGTTTGTGGGGAGTGG - Intronic
919992360 1:202717294-202717316 TGGCCAGGGGTTAGGGTGGTAGG - Intergenic
920005565 1:202831173-202831195 TGGCCAGGGGCTGGGGAAAGGGG + Intergenic
920048565 1:203149524-203149546 AGGCCGGGAGTTGAGGAGAGGGG + Intronic
920048970 1:203151947-203151969 AGCCCAGGGGCAGTGGTGAGGGG - Intronic
920111874 1:203592593-203592615 AGGCTGGGGGATGGGGTGGGGGG + Intergenic
920203555 1:204275527-204275549 AACCCAGGGGTTGGGGGGTGGGG + Intronic
920295201 1:204951884-204951906 AGGCAAGTGGGTGGGGTGTGGGG - Intronic
920992160 1:210949822-210949844 AGGCCTGGAATTGGAGTGAGCGG - Intronic
921218547 1:212957030-212957052 TTGCCAGGGGCTGGGGAGAGAGG - Intronic
921342830 1:214151764-214151786 TTGCCAGGGGCTGGGGAGAGAGG + Intergenic
921599174 1:217089119-217089141 AGGGGAGGGGTTAGGGTGAGGGG - Intronic
921921792 1:220677848-220677870 TTGCCAGGGGGTGGGGAGAGGGG + Intergenic
922814850 1:228441317-228441339 AGGGAAGGAGATGGGGTGAGCGG - Intergenic
923141668 1:231165077-231165099 TGGGGAGGGGTTGGGGTAAGGGG - Intronic
923294075 1:232576006-232576028 CTGCCAGGGATTGGGGTGAGGGG + Intergenic
923510893 1:234651847-234651869 AGGCTGGGGGTGGGGGTGAGTGG - Intergenic
923797728 1:237174523-237174545 AGGTCAGGGGTTGGGGTAGTGGG - Intronic
923970591 1:239199194-239199216 AGTCCTGGGGGTGGGGGGAGAGG - Intergenic
924518766 1:244787856-244787878 ACTCCAGGGGCTGAGGTGAGAGG + Intergenic
1062861197 10:811546-811568 CGGCCCTGGGTTGGCGTGAGTGG - Exonic
1062874386 10:932393-932415 GGTCCCGGGGGTGGGGTGAGGGG - Intergenic
1062953275 10:1521784-1521806 AGGGAAGGGGTTGGGGGTAGTGG - Intronic
1063074921 10:2705458-2705480 TTGCCAGGGGCTGGGGTGAGGGG - Intergenic
1063970176 10:11376338-11376360 AAGCCAGGGCTTGGGGTCAGGGG - Intergenic
1064035115 10:11908465-11908487 AGGCCTGGGGCTGGGGTCTGAGG - Intergenic
1064576940 10:16756168-16756190 TGGCCAGGGGCTGGAGGGAGGGG + Intronic
1064582659 10:16809982-16810004 AGGCCGGGGGTGGGGGGGGGAGG + Intronic
1065532609 10:26687838-26687860 AGGACAGGGATTGGGTTGTGTGG - Intergenic
1065626850 10:27638551-27638573 AGGCCAGGAGTGGGGGTAGGGGG + Intergenic
1065755594 10:28927615-28927637 AGGACAGGGGTAGGGTTGGGGGG + Intergenic
1066008718 10:31172282-31172304 AGGGCAGGGATTGGGATGATTGG - Intergenic
1066698755 10:38104088-38104110 GGGCCAGGGGTGGGGATAAGGGG - Intronic
1067013184 10:42733506-42733528 TGGCCAGGGGCTGGAGGGAGGGG - Intergenic
1067310652 10:45110594-45110616 TGGCCAGGGGCTGGAGGGAGGGG + Intergenic
1067972630 10:50990872-50990894 AGGGAAGGGGGTGGGGTGGGGGG - Intergenic
1068821643 10:61383666-61383688 AAAACAGGGGTTGGGGTGTGTGG - Intergenic
1069510615 10:69039889-69039911 AGGTCTGGGGCTGGGGTGGGGGG + Intergenic
1069779023 10:70943274-70943296 TGGCCAGGGGTTGAGGTCAGGGG + Intergenic
1070114565 10:73516343-73516365 CAACCAGGGGTTGGGGGGAGGGG - Intronic
1070150768 10:73803527-73803549 AGGCTAAAGGTTGGGGGGAGGGG - Intronic
1070554241 10:77515810-77515832 AGCCCAGGGGCTGGAGGGAGGGG - Intronic
1070648863 10:78220671-78220693 AGGCCAGGGCGGGGGGAGAGGGG - Intergenic
1070744474 10:78924761-78924783 AGGCCTGGGGTTGCAGAGAGAGG - Intergenic
1070788661 10:79176904-79176926 AGGCCAGGGATTGGAGTTTGTGG + Intronic
1070838492 10:79467039-79467061 ATGCCAGGGGCTGGGGAGGGTGG + Intergenic
1071563273 10:86658966-86658988 AGGCAGGGGGCTGGGGTGTGAGG + Intronic
1072247423 10:93555626-93555648 AGGATAGGGGTGGGGGTGGGAGG - Intergenic
1072767472 10:98107413-98107435 TTGCCAGGGGCTGGGGAGAGAGG - Intergenic
1072806069 10:98424682-98424704 AGGGCAGCGGCTGGGGTGTGCGG + Intronic
1072909909 10:99491171-99491193 AGGGGAGGGGTTGGGGTGAGAGG - Intergenic
1072976108 10:100060072-100060094 TTGCCAGGGGCTGGGGTAAGGGG + Intronic
1073015028 10:100391839-100391861 ATGGCAGGGGTTGGGGAGTGGGG - Intergenic
1073143450 10:101263846-101263868 AGGGCTGGGGTTGGGGTCTGAGG + Intergenic
1073198232 10:101713041-101713063 GAGGCAGGGGTTGGGGTGATTGG - Intergenic
1073241644 10:102062872-102062894 AGGCCAGGAGTTGGAGTCTGTGG - Intergenic
1074382843 10:112994251-112994273 TTGCCAGGGGCTGGGGGGAGAGG - Intronic
1074530727 10:114297153-114297175 TGGACATGGGTTGGGGTGGGTGG - Intronic
1074561121 10:114536097-114536119 ATGCCAGGGGCTGGGGGAAGGGG - Intronic
1074710998 10:116177433-116177455 AGGGCAGGCCTTGGGGTTAGGGG + Intronic
1074776109 10:116769437-116769459 GGGCCAGGACTTGGGGTGAAAGG + Intergenic
1074899535 10:117804343-117804365 AGGCCTGGGGATCGGGGGAGGGG - Intergenic
1075016109 10:118910923-118910945 AGGCCAGGCAGTGGGGTGAGGGG + Intergenic
1075045618 10:119143939-119143961 GGGCGAGGGGTTGGGGAGCGAGG - Intronic
1075623349 10:123944080-123944102 AGGCCCCGGGCTGGGGTGTGAGG + Intergenic
1076773816 10:132682020-132682042 TTGCCAGGGGCTGGGGAGAGCGG + Intronic
1076824821 10:132961616-132961638 AGGCATGAGGTGGGGGTGAGGGG - Intergenic
1077042709 11:531598-531620 AGGGCAGGGGCGGGGGAGAGTGG + Intergenic
1077154712 11:1086102-1086124 AGGCCAGGGGGAGTGGTGGGAGG + Intergenic
1077220359 11:1413005-1413027 AGGCCAGGGCCTGGGGTGCCGGG - Intronic
1077254048 11:1572682-1572704 AGGCCAGGAGAAGGGGGGAGCGG - Intergenic
1077298559 11:1837157-1837179 AGGCCAGAGGTTGGAGTTGGGGG - Intronic
1077319226 11:1933667-1933689 AGGGCAGAGGTTGGAGAGAGGGG + Intronic
1077394534 11:2314655-2314677 AGGCCAAGGGGTGGGGTGGGAGG - Intronic
1077413462 11:2414011-2414033 CTGCCAGGGGGTGGGGTGGGCGG - Intronic
1077437424 11:2549618-2549640 AGGCCCGGGGTAGGGGCGTGGGG + Intronic
1077551777 11:3203588-3203610 AGGCTGGGGGTGGGGGTGGGGGG + Intergenic
1077896650 11:6458019-6458041 AGGCCGGGACTTGGGGTGGGAGG - Intronic
1078101736 11:8334214-8334236 AGGTCAGGCATGGGGGTGAGTGG - Intergenic
1078507990 11:11966273-11966295 AGGCCTGGGGTTGAGCTCAGTGG + Intronic
1079003350 11:16775584-16775606 AGCCCAGGGGTTAGAGAGAGAGG + Intergenic
1080445355 11:32333297-32333319 CGGCCGGGGGTGGGGGTGGGGGG - Intergenic
1080466488 11:32502361-32502383 AGACCAGGGGGTGGAGTGGGGGG - Intergenic
1080628663 11:34052748-34052770 GGGCCAGGGGGTGGGAGGAGGGG - Intronic
1080649227 11:34209603-34209625 GGGGTAGGGGTGGGGGTGAGGGG + Intronic
1080649253 11:34209660-34209682 GGGTGAGGGGTAGGGGTGAGGGG + Intronic
1080649263 11:34209679-34209701 GGGGTAGGGGTGGGGGTGAGGGG + Intronic
1081482222 11:43500239-43500261 TGGCTAGGGGATGGGCTGAGAGG - Intergenic
1081574629 11:44311229-44311251 GGGTCAGGGGTCGGGGAGAGGGG + Intergenic
1081723371 11:45306428-45306450 GGTCCTGGGGTTGGGGTGATGGG - Intergenic
1081852209 11:46281575-46281597 AGGCCAGGTGTGGGAGTGACGGG + Intronic
1081946750 11:47002623-47002645 AAGGCAGGGGGTGGGGTGGGGGG - Intronic
1082008676 11:47436038-47436060 AGGGCAAGGCCTGGGGTGAGAGG - Intergenic
1082810213 11:57474995-57475017 AGGCTGGGTATTGGGGTGAGGGG - Intronic
1083142673 11:60734651-60734673 TTGCCAGGGGCTGGGGTAAGAGG + Intronic
1083158760 11:60841954-60841976 GGGACCGGGGTTGGGGAGAGTGG - Intergenic
1083164660 11:60876167-60876189 AGGCCAGGGGAAGGGATGGGAGG - Intergenic
1083457845 11:62790924-62790946 AGGGCAGAGATTGGGGTGAGGGG + Intronic
1083625963 11:64072130-64072152 CAGCCAGGGGTGGGAGTGAGTGG + Intronic
1083659986 11:64247447-64247469 AAGCCGGGGCTGGGGGTGAGCGG + Intergenic
1083756157 11:64792638-64792660 AGGCCAGGGGTTTGGGTCTCAGG + Intronic
1083949690 11:65947198-65947220 TGGCCAGGGGTTGGGGAGCTTGG - Exonic
1084038954 11:66530618-66530640 AGGCAGGGGGTGGGGGTGAGGGG + Intronic
1084041513 11:66545715-66545737 GGGCCAGGGCTGGGCGTGAGTGG - Exonic
1084052234 11:66607391-66607413 AGTCCAAGGGTTGGGGCTAGAGG - Intergenic
1084100160 11:66942565-66942587 GTGCCAGGGGCTTGGGTGAGTGG + Intronic
1084126137 11:67100204-67100226 AAGGCAGGGGTAGGGGAGAGGGG + Intergenic
1084204800 11:67585119-67585141 AGCCCTGGGGTTGGGTGGAGGGG - Exonic
1084213040 11:67632557-67632579 ATGCCTGGGGTGGGGGTGAGGGG + Intronic
1084492196 11:69485036-69485058 AGGACAAGGTGTGGGGTGAGTGG - Intergenic
1084519984 11:69657176-69657198 AGGCTGGGGGTTGGGGGCAGAGG - Intronic
1084641600 11:70429666-70429688 AGCCCAGGGGCTTGGGTGAGCGG - Intronic
1084677139 11:70642067-70642089 AGGACAGGGGCTGGGGTCACTGG + Intronic
1084758482 11:71253139-71253161 AAGCCAGGGGGTGGGGTGGGGGG + Intergenic
1085122188 11:73974353-73974375 AGGCCTGCGGCTGGGGTGGGGGG + Intergenic
1085295383 11:75428742-75428764 AGGCCGGGGGATCGGGTGGGCGG - Intronic
1085399016 11:76224478-76224500 AGGCCAGGGGTGGTGTTGACAGG + Intergenic
1085719787 11:78903001-78903023 AGGCAAGGGGTTGGTGCGGGGGG + Intronic
1086217486 11:84401379-84401401 AGTCCAGGGGTTGGGGGTGGAGG - Intronic
1087968892 11:104454622-104454644 AGGCCTGGGGTGGGGGAGGGAGG - Intergenic
1087969559 11:104462491-104462513 ACGCAAGGGGTTGGGGAGTGGGG + Intergenic
1088254710 11:107892310-107892332 TTGCCAGGGGTGGGGGTGGGGGG - Intronic
1088396815 11:109378301-109378323 GAGATAGGGGTTGGGGTGAGGGG - Intergenic
1088476206 11:110242005-110242027 TTGCCAGGGGTTGTGGGGAGGGG + Intronic
1088484477 11:110327671-110327693 TTGCCAGGGGCTGGGGAGAGGGG + Intergenic
1088781318 11:113136704-113136726 AGGCCAGGAATTGGCTTGAGGGG + Intronic
1089216356 11:116836956-116836978 AGGGCAGGGGTAGGGGGCAGAGG - Intronic
1089625216 11:119746828-119746850 AGGCCAAGGGTGGGGGGGGGGGG + Intergenic
1090028798 11:123189929-123189951 AAGGCAGGGGTTGCAGTGAGTGG + Intronic
1090651515 11:128810579-128810601 TGGCCAGGCGCTGGGGCGAGCGG + Exonic
1091261440 11:134237814-134237836 AAGCAAGGGGTTGGGAGGAGTGG + Intronic
1091438070 12:489157-489179 CTGTCAGGGGTTGGGGTGGGGGG + Intronic
1091455331 12:602939-602961 AGTCAAGAGGTTGGGGTGGGAGG - Intronic
1091642330 12:2246799-2246821 TGGCCAAGGTTGGGGGTGAGGGG + Intronic
1091710109 12:2733917-2733939 AGGCAAGGGGTCGGGGTGGGGGG - Intergenic
1091838854 12:3604957-3604979 TGGCCGGGGGTGGGGGTGAGGGG + Intergenic
1091982889 12:4880807-4880829 AGGAAATGGGTTGGGGAGAGTGG - Intergenic
1092228796 12:6765958-6765980 TTGCCAAGGGGTGGGGTGAGGGG - Intronic
1092474587 12:8807755-8807777 AGGCTTTGGGTTGGGGAGAGGGG - Intergenic
1092715480 12:11384990-11385012 CTGCCATGGGTTGGGGGGAGGGG + Intronic
1092843243 12:12562558-12562580 AGGCGGGGGGGTGGGGTGGGGGG + Intergenic
1092852130 12:12638972-12638994 TTGCCAGGGGTTGGGGGAAGTGG - Intronic
1093130591 12:15387356-15387378 AAGCCCGGGGTTGGGGAGGGGGG + Intronic
1093235717 12:16606525-16606547 AGGGGAGGGGTGGGGGCGAGAGG - Intronic
1093513746 12:19960500-19960522 TGGGCAGGGGTTTGGGAGAGTGG + Intergenic
1094186383 12:27647301-27647323 TGGCCAGGGGTAGGGGGGAGAGG - Intronic
1094388668 12:29923749-29923771 TGGCCAGGGGTTGGGGAGAGTGG + Intergenic
1094462784 12:30715494-30715516 TTGCCAGGGGCTGGGGGGAGAGG + Intronic
1094470427 12:30796786-30796808 AGGCAGGGGGTTGGGGTGGTCGG - Intergenic
1095228824 12:39709508-39709530 TGGCCAGGGGCTGGGGGGAGGGG - Intronic
1095440699 12:42237415-42237437 AGGCGATGGTTTGCGGTGAGGGG - Intronic
1095476062 12:42588960-42588982 GGGCAGGGGGTTGGGGAGAGTGG + Intronic
1095486304 12:42688255-42688277 GGGTCAGGGGGTGGGGTGTGGGG + Intergenic
1095705677 12:45234719-45234741 AGCCCAGGGGTGGGGGTGGGGGG - Intronic
1096110625 12:49027106-49027128 AGGCCAGTGGCAGAGGTGAGGGG + Exonic
1096186311 12:49583777-49583799 AGGCCAAGGGTGCTGGTGAGTGG + Intronic
1096406166 12:51345922-51345944 CAGCCAGGGGTAGGGGTGGGGGG + Intronic
1096528941 12:52231481-52231503 AGAGCAGGCGTTGGTGTGAGAGG + Intergenic
1096542045 12:52313391-52313413 AGGCCAGGGGCTGGGTGAAGGGG + Intergenic
1096805971 12:54141308-54141330 AGGCTGGGGGCTGGGGAGAGAGG - Intergenic
1096808950 12:54157628-54157650 AACCCAGGGGTGGGGGTGATTGG + Intergenic
1096909213 12:54965342-54965364 CTGTCAGGGGATGGGGTGAGAGG - Intronic
1097055952 12:56249182-56249204 AGGGCAGGGGTTGGCGTGCCTGG - Intronic
1097058872 12:56267578-56267600 AGGGCTGGGGGCGGGGTGAGGGG - Intronic
1097160366 12:57042145-57042167 ATGCCAAGGGCTGGGGGGAGAGG - Intronic
1097723150 12:63045531-63045553 AGGCCTCAGGTGGGGGTGAGTGG - Intergenic
1098253976 12:68597911-68597933 TGGTCAGGGGCTGGGGTGAGGGG - Intergenic
1098953450 12:76665240-76665262 GGGAGAAGGGTTGGGGTGAGAGG - Intergenic
1100451673 12:94712656-94712678 AGGCTGGGGGTGGGGGTGGGTGG - Intergenic
1100531688 12:95467333-95467355 AGCCCAGGGGCGGGGGTGGGGGG + Intergenic
1101326951 12:103723985-103724007 AAGCCAGGGGATGGGGACAGGGG + Intronic
1101490334 12:105204070-105204092 AGGGCAGGGGTATGGGAGAGGGG + Intronic
1101961728 12:109255980-109256002 AGGGAAGGGGTTGGGCTGTGTGG + Intronic
1102250912 12:111387023-111387045 TTGCCAGGGGCTGGGGGGAGGGG - Intergenic
1102252596 12:111397439-111397461 GGGTCTGGGGTTGGGGTGCGCGG + Intergenic
1102573492 12:113841768-113841790 GGGCCAGTGGGTGGGGTGGGAGG + Intronic
1102896656 12:116603624-116603646 GGGGCAGGGGTTGGGGGGTGGGG + Intergenic
1103133598 12:118488960-118488982 GGGCCAGGTGTTGGGGGCAGAGG - Intergenic
1103364139 12:120369724-120369746 AGCCCTGGGGTGGGGGTGGGGGG - Intergenic
1103496923 12:121370161-121370183 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
1103900797 12:124302794-124302816 AGGTCAGGGGCTGAGGTCAGGGG + Intronic
1103992915 12:124811200-124811222 GGGCAAGGGGTAGGGGTGGGAGG + Intronic
1104057788 12:125243922-125243944 TGGGCAGGGGCTGGGGGGAGAGG - Intronic
1104414394 12:128585872-128585894 GTGCCAGGGGCTGGGATGAGGGG + Intronic
1104440910 12:128792297-128792319 AGGCCAGGAGCTGGGGTCAAGGG + Intergenic
1104681559 12:130755427-130755449 AGCACTGGGCTTGGGGTGAGGGG - Intergenic
1104953787 12:132454148-132454170 AGGCCCGGGCTGGGGGTGGGGGG - Intergenic
1104980316 12:132570568-132570590 AGGGCAGGGGTTGGGGGGTGCGG + Intronic
1105007265 12:132729372-132729394 AGTCGAGGGGATGGGGTGGGGGG + Intronic
1105028807 12:132868764-132868786 CTGCCAGGGGCTGGGGGGAGGGG + Intronic
1105073450 12:133252745-133252767 AGGCAAGCTGGTGGGGTGAGGGG - Intergenic
1105437595 13:20391263-20391285 AGGACAGGGGTTGGGGGAAACGG + Intergenic
1105437632 13:20391355-20391377 AGGCGAGGGGTTGGGGGGGAAGG + Intergenic
1105437676 13:20391470-20391492 AGGCGAGGGGTTGGGGGGAAAGG + Intergenic
1105449951 13:20490648-20490670 ATGGCAGGGGATGGGGTGGGGGG + Intronic
1105720712 13:23111261-23111283 AGGCCAGAGCTTGTAGTGAGCGG + Intergenic
1105927093 13:25018320-25018342 AGCCCAGGGATGGGGTTGAGTGG + Intergenic
1106033422 13:26022900-26022922 AGACCAAGGGTTGGCCTGAGTGG - Exonic
1106073168 13:26433652-26433674 GGGCCAGGGGGTGGGAGGAGGGG + Intergenic
1106103081 13:26710854-26710876 TGGCCAGGGGCTGAGGGGAGGGG - Intergenic
1106129263 13:26926073-26926095 AGTCCTGGGCTTGGGCTGAGAGG - Intergenic
1106612476 13:31296928-31296950 TTGCCAGGGGATGGGGTTAGGGG - Intronic
1107549047 13:41457969-41457991 GCGCCCGGGGTTGGGGGGAGCGG + Intronic
1107598862 13:41992135-41992157 TGACCAGGGGCTGGGGTGAAGGG - Intergenic
1108008720 13:45980734-45980756 TTGCCAGGGGTTGGGGCCAGGGG + Intronic
1108302267 13:49090590-49090612 CAGCCAGGGGGTGGGGTGGGGGG - Intronic
1108346132 13:49548779-49548801 TTGCTAGGGGTTGGGGGGAGAGG + Intronic
1108550883 13:51542613-51542635 AGCCCAGGGGTCGGGGGAAGTGG - Intergenic
1109891883 13:68625162-68625184 CTGCCAAGGGTTGGAGTGAGGGG + Intergenic
1110094238 13:71496165-71496187 GGGGCAGAGGTTGCGGTGAGCGG + Intronic
1110428099 13:75392014-75392036 AGGAAAGGGGTTGGGGAGAAAGG - Intronic
1110655895 13:77998288-77998310 AGGCCAGAGCTAGAGGTGAGAGG + Intergenic
1111920961 13:94410760-94410782 AGGCCCGGGGGTGGGGGGGGGGG + Intergenic
1111949890 13:94702074-94702096 AGGCCATGGGTGGGGGCGGGTGG + Intergenic
1112412808 13:99178663-99178685 AAGCCTGGGTTTGGAGTGAGAGG - Intergenic
1112508369 13:99988924-99988946 GGGCCTGGGGGTGGGGTGGGGGG + Intergenic
1112508374 13:99988957-99988979 AGGGGTGGGGTTGGGGTGGGGGG - Intergenic
1112636337 13:101221955-101221977 AGGTCTGGGGTGGGAGTGAGTGG - Intronic
1112651979 13:101409455-101409477 TGGCCAGGGGCTGGGAGGAGGGG - Intronic
1112940358 13:104854494-104854516 TGGCCTGGGGTTGCGGGGAGGGG - Intergenic
1113378920 13:109786088-109786110 CGCCCAGGGGTTGGGGCGAGGGG + Exonic
1113898890 13:113784848-113784870 AGGACAGGTGTTGGGGCCAGAGG - Intronic
1114270012 14:21094715-21094737 AGGATAGGGGTTGGGGGGGGGGG + Intronic
1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG + Exonic
1115645907 14:35368265-35368287 AGGGCAAGGTTTGGGGTTAGTGG + Intergenic
1116650037 14:47578248-47578270 AGTCAGGGGGTGGGGGTGAGGGG + Intronic
1116999835 14:51361217-51361239 AGGCTTGGGGTTGGGGAGGGTGG + Intergenic
1118019417 14:61695681-61695703 AGTCCAGAGGTGGGGGTGCGAGG - Intronic
1118128568 14:62936908-62936930 GAGGCAGAGGTTGGGGTGAGTGG + Intronic
1118764361 14:68900002-68900024 AGGCCAGAGGAGGGGCTGAGAGG + Intronic
1118908335 14:70040093-70040115 AGGGGATGGGTTGGGGAGAGAGG + Intergenic
1119034174 14:71215788-71215810 AGGCCAGAGATTTGGGTTAGGGG + Intergenic
1119151023 14:72359370-72359392 GTGCCAGGGGTTGGGGTGGGGGG + Intronic
1119381737 14:74233588-74233610 GGGGCAGGGGGTGGGGTTAGGGG - Intergenic
1119433540 14:74583690-74583712 AGGCTAGGTGATGGGGAGAGGGG - Intronic
1119439796 14:74620446-74620468 AGCCAAGGTGTTTGGGTGAGGGG - Intergenic
1119476284 14:74931742-74931764 AGGCAAGAGGCTGAGGTGAGAGG + Intergenic
1119857993 14:77915330-77915352 AGGCTGGGGGTAGGGGGGAGGGG - Intronic
1120228569 14:81818250-81818272 AGGTCCTGGGTTGGGGTGACAGG - Intergenic
1121267323 14:92612703-92612725 AGGGCAGGGGCTGGGGCCAGGGG + Intronic
1121278039 14:92680956-92680978 GGGGCAGGGGGTGGGGGGAGTGG - Intronic
1121462676 14:94094064-94094086 AGGACTGGGGTTGGGGTGCAGGG - Intronic
1121491375 14:94363673-94363695 GGGCCAGGGGTGGAGGGGAGGGG + Intergenic
1121675176 14:95746537-95746559 AGGGGAGGGGTTGGGGTGCTGGG + Intergenic
1121875517 14:97447614-97447636 AGGGCAGGGGTGGGAGAGAGAGG - Intergenic
1122143831 14:99677273-99677295 AGGGCAGTGGTTAGGGTGCGGGG - Exonic
1122407057 14:101506977-101506999 AGCCGAGGGGCTGGGGTGGGCGG - Intergenic
1122560706 14:102612263-102612285 AGGCCAAGGTTTGGGAAGAGGGG - Intronic
1122643402 14:103175764-103175786 ACACAAGGGGTTCGGGTGAGTGG + Intergenic
1122820665 14:104343227-104343249 AGGTGGGGAGTTGGGGTGAGTGG + Intergenic
1122822183 14:104353247-104353269 AGTCCAGGGGTTGGGGGCTGGGG + Intergenic
1123101024 14:105800938-105800960 TTGCCAGGGTTTGGGGTGAGGGG + Intergenic
1123142619 14:106095447-106095469 AGGCCAGGGGCTGGTGTTGGGGG - Intergenic
1123167007 14:106335231-106335253 AGGCAAGGGGCTGGAGTGGGTGG - Intergenic
1123169625 14:106359942-106359964 AGGCAAGGGGCTGGAGTGGGTGG - Intergenic
1123218247 14:106831915-106831937 AGGACAGGGGTTGGTGTGGGAGG - Intergenic
1123907808 15:24937774-24937796 TTGCCAGGGGATGGGGTGTGGGG - Intronic
1124095834 15:26648149-26648171 TGGCCAGGGGCTGGGGCTAGGGG - Intronic
1124169086 15:27356261-27356283 AGGGTAGGGGGTGGGGAGAGAGG + Intronic
1124502175 15:30238459-30238481 ATGCCAGGGGTGGGGGAGAGGGG - Intergenic
1124741389 15:32300193-32300215 ATGCCAGGGGTGGGGGAGAGGGG + Intergenic
1124808164 15:32907117-32907139 AGGCCAGGGGTTGGGGTTGGAGG + Intronic
1125034544 15:35108908-35108930 AGGCCAGGGCTTGAGGTCACAGG - Intergenic
1125679939 15:41524175-41524197 TGGACAGGGGTTGAGGTGGGTGG + Exonic
1125723081 15:41854394-41854416 AGGCCAGGGGGTGGGGAGGGTGG + Intronic
1125885630 15:43227116-43227138 AGGACAAGGGTTGGCGTGAGAGG + Intergenic
1125973109 15:43928291-43928313 AAGGCTGGGGTGGGGGTGAGGGG + Intronic
1126436803 15:48645458-48645480 GGGACAGGGACTGGGGTGAGGGG - Intronic
1126709947 15:51444003-51444025 AGGCCTGGTGTTGGGGTCCGAGG + Intergenic
1127404058 15:58622369-58622391 AGGGGAGGAGTTGGGGTTAGGGG - Intronic
1127414462 15:58744239-58744261 AGGTGAGGGGTAGGGGTGGGGGG + Intronic
1127873336 15:63091152-63091174 AGCCCCTGGGGTGGGGTGAGAGG - Intergenic
1128007197 15:64254212-64254234 TGCCAAGGGGTTGGGGGGAGGGG + Intronic
1128081347 15:64858930-64858952 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
1128115688 15:65103543-65103565 AGGCTAGGGGTTGGGGAGTGAGG + Intronic
1128186380 15:65646482-65646504 TGGCCAGGGGCTGGGGAGGGGGG - Intronic
1128203690 15:65831730-65831752 TTGCCAGGGGTTGGGGAGAGAGG - Intronic
1128227651 15:66013358-66013380 AGACCTGGGGTGGGGGTGGGAGG - Intronic
1128301237 15:66567574-66567596 AGGCCAGGGGGTGGGTGGGGTGG + Intergenic
1128657164 15:69470730-69470752 ATACCTGGGGTGGGGGTGAGGGG - Intergenic
1128664018 15:69525170-69525192 TGCCCTGGGTTTGGGGTGAGAGG - Intergenic
1128734367 15:70044392-70044414 AGGCTACTGGTGGGGGTGAGGGG + Intergenic
1129075142 15:72988432-72988454 TTGCCAGGGGATGGGGTGAGGGG + Intergenic
1129275662 15:74443607-74443629 GGGCTAGGGGTGGGGGTGTGAGG - Intergenic
1129361894 15:75029567-75029589 AGCCCTGGGGGTGGGGTGATGGG - Intronic
1129473330 15:75767007-75767029 GGGGAAGGGGTTGGGGGGAGGGG + Intergenic
1129502454 15:76052413-76052435 AGGCTAGGAGTTGGGTTAAGAGG + Intronic
1129627155 15:77213932-77213954 AGGCCAGGAGTTAGGGAGAAGGG - Intronic
1129736973 15:77972068-77972090 GGGCCTGGGGTGAGGGTGAGAGG + Intergenic
1129849098 15:78781547-78781569 GGGCCTGGGGTGAGGGTGAGAGG - Intronic
1129896343 15:79109923-79109945 AGGCCAGGGGTTGTGGGGAGTGG + Intergenic
1129976726 15:79828966-79828988 AGGCCAGGGCATGGGGCAAGTGG + Intergenic
1130084037 15:80762306-80762328 ATGCCAGGGGCTTGGGTGACAGG - Intergenic
1130345774 15:83043368-83043390 AGGCCAGAGGCTGTGGGGAGAGG + Intronic
1130581119 15:85137446-85137468 AGGCCATCGGTTGGGGCGGGGGG + Intronic
1130998372 15:88918269-88918291 TTGCCAGGGGCTGGGGTGAGGGG + Intergenic
1131063797 15:89420502-89420524 AGGCTGGGGGTTGGGGGCAGTGG + Intergenic
1131092286 15:89631974-89631996 AGGCAATGGGTAGGGGTGGGAGG + Intronic
1131117371 15:89803504-89803526 CGCCCTGGGGTGGGGGTGAGGGG + Exonic
1131534034 15:93219322-93219344 AGTGCAGGGGTTGGCTTGAGAGG - Intergenic
1131541586 15:93279574-93279596 GGGTGAGGGGTGGGGGTGAGGGG - Intergenic
1131971286 15:97895626-97895648 TTGCCAGGGGTTGAGGGGAGGGG + Intergenic
1131975971 15:97946280-97946302 AGACGAGGGGTTGGAATGAGTGG + Intergenic
1132323588 15:100946297-100946319 TGGGGAGGGGATGGGGTGAGAGG + Intronic
1132423602 15:101695269-101695291 AGTCCAGTGGGTGGGGAGAGGGG - Intronic
1132569688 16:638626-638648 GGGGCAGGGGTGGGGGTGGGAGG + Intronic
1132589018 16:718315-718337 ATCCGAGGGGTTGGGGTGAGAGG - Exonic
1132594306 16:741195-741217 AGGCCCCGGGTTGGGGTGCAGGG + Intronic
1132603180 16:782913-782935 AGGCCAGGCATGGAGGTGAGCGG - Intronic
1132703637 16:1231981-1232003 AGGTGAGGGGATGGGGTGACGGG + Intergenic
1132704872 16:1239380-1239402 AGGTGAGGGGATGGGGTGACGGG - Intergenic
1132707881 16:1254414-1254436 AGGTGAGGGGATGGGGTGACGGG - Intergenic
1132766776 16:1538332-1538354 AGGCCAGGGCTGAGGGCGAGAGG + Intronic
1132887739 16:2189900-2189922 AGGGGTGGGGCTGGGGTGAGGGG - Intronic
1133035426 16:3031368-3031390 GGGGCAAGGGTTGGGGTGGGGGG + Intronic
1133056377 16:3147466-3147488 AGGCCTGCCGTGGGGGTGAGCGG + Exonic
1133327728 16:4952377-4952399 GGGCTAGGGGCTGGGGGGAGGGG - Intronic
1133802161 16:9092446-9092468 AGGCCCGGGGTTGGGGGGACAGG + Intronic
1134063735 16:11213642-11213664 AGGCCAGGTGGTGGGGGAAGGGG + Intergenic
1134118001 16:11563847-11563869 AGACAAAGGGTTGGGGTGGGGGG + Intronic
1134331016 16:13251267-13251289 AATACAGGAGTTGGGGTGAGGGG - Intergenic
1134615494 16:15648508-15648530 AAGGCAGAGGTTGCGGTGAGTGG - Intronic
1134849432 16:17468852-17468874 AGCCCAGGAGGTGGGGTGGGAGG - Intronic
1134865336 16:17601915-17601937 AGGCTAGGGTTTGGGGGGAGGGG - Intergenic
1135101955 16:19613703-19613725 TGGCCATGGGTTGGGGTCTGGGG + Intronic
1135461834 16:22651261-22651283 CTGCCAGGGGGTGGGGGGAGCGG - Intergenic
1135751595 16:25062696-25062718 AGGCCGGGGGTGGGGGTGGGGGG + Intergenic
1136037833 16:27553958-27553980 AGAGCAGGGGGTGGGGTGGGGGG + Intronic
1136296652 16:29307850-29307872 AGGCCAGTGGTTGTGGAGGGAGG + Intergenic
1136511517 16:30740590-30740612 AGCCCAGGGGTGGGGTTGAGTGG - Exonic
1136596419 16:31253235-31253257 AGGGCTGGGGTTGGGATGACAGG + Intergenic
1136694264 16:32062644-32062666 AGGCCTGGGGTTGGTGTGGGTGG + Intergenic
1136707052 16:32200132-32200154 GGGCCAGGGGCCGGGGGGAGGGG + Intergenic
1136737049 16:32475026-32475048 GGGGCAGGGGCTGGGGAGAGTGG + Intergenic
1136760858 16:32729285-32729307 GGGCCAGGGGCCGGGGGGAGGGG - Intergenic
1136794761 16:33005908-33005930 AGGCCTGGGGTTGGTGTGGGTGG + Intergenic
1136807245 16:33141101-33141123 GGGCCAGGGGCCGGGGGGAGGGG + Intergenic
1136875144 16:33848484-33848506 AGGCCTGGGGTTGGTGTGGGTGG - Intergenic
1136984193 16:35084199-35084221 AGGTTTGGGGTTGTGGTGAGAGG - Intergenic
1137785260 16:51133234-51133256 AGACCGGGGGTGGGGGTGGGGGG + Intergenic
1138023439 16:53503965-53503987 GGGCCGGGGGCTGGGGGGAGGGG + Intronic
1138157322 16:54718208-54718230 AGGATGGGAGTTGGGGTGAGGGG - Intergenic
1138354354 16:56365716-56365738 AGAGCAGGGGTTGCGGTGGGCGG - Intronic
1138540042 16:57682471-57682493 AGGCCAGGGCTTGGAGGGTGGGG - Intronic
1138629799 16:58284468-58284490 AGGGCAGGGCTTGGGATGAGTGG - Intronic
1138639082 16:58368560-58368582 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
1138951214 16:61915785-61915807 AGGCTAAGGATTGAGGTGAGTGG + Intronic
1138969221 16:62124329-62124351 CTGACAGGGGTTGGGGTGTGGGG + Intergenic
1139422543 16:66857417-66857439 TGGCCTGGGGTTGGGGAGAGAGG + Intronic
1139586984 16:67910303-67910325 AGCTCAGGGGGTGGGCTGAGAGG + Intronic
1140004748 16:71063629-71063651 AAGCCAAGGGTTAGGGTGACAGG - Intronic
1140041114 16:71408865-71408887 ATGCCTGGGGTTGGGGTCAGGGG - Intergenic
1140742309 16:77952454-77952476 AGGCGAGGGGTGGTGGTGGGGGG - Intronic
1140921867 16:79545738-79545760 AAGCCAGGGGATGGGGAGTGGGG + Intergenic
1141107166 16:81243068-81243090 CTGCCAGGGGCTGGGGTAAGGGG + Intronic
1141577276 16:84972107-84972129 AGGCCAGAGGTTGCAGTGAGCGG + Intergenic
1141971637 16:87487955-87487977 TGGTCAAGGGTTGGGGGGAGGGG + Intronic
1142113882 16:88346410-88346432 AGGCCAGGGCTGGGAGGGAGGGG - Intergenic
1203016022 16_KI270728v1_random:354551-354573 GGGGCAGGGGCTGGGGAGAGTGG - Intergenic
1203034357 16_KI270728v1_random:627709-627731 GGGGCAGGGGCTGGGGAGAGTGG - Intergenic
1203063010 16_KI270728v1_random:989599-989621 GGGCCAGGGGCCGGGGGGAGGGG - Intergenic
1203097024 16_KI270728v1_random:1267558-1267580 AGGCCTGGGGTTGGTGTGGGTGG + Intergenic
1142504535 17:354466-354488 AGGCCTGGGGCTGTGGTGTGCGG - Intronic
1142762931 17:2051894-2051916 GCGCCAGAGGTAGGGGTGAGAGG + Intergenic
1142920814 17:3184090-3184112 AGTCTAGGGGTGGGGTTGAGGGG - Intergenic
1143022953 17:3926088-3926110 GAGCCAGGAGGTGGGGTGAGAGG + Intronic
1143377889 17:6478141-6478163 TGGCCGGGTGTGGGGGTGAGGGG - Intronic
1143452535 17:7044061-7044083 AGGCCCGGGGGAGGGGGGAGCGG + Intergenic
1143572839 17:7771301-7771323 GGGCCAAAAGTTGGGGTGAGAGG - Intronic
1143631016 17:8140432-8140454 AAGTTTGGGGTTGGGGTGAGGGG - Intergenic
1143732025 17:8886774-8886796 AGGCCAGTGGGTCAGGTGAGGGG - Intronic
1144131549 17:12251404-12251426 GGGCCAGGGGTGGGGGTGGAGGG + Intergenic
1144286851 17:13785368-13785390 AGGCCTGGGGCTGGGGGGTGGGG + Intergenic
1144443913 17:15309036-15309058 AAGCCTAGGGTTGGGGAGAGAGG - Intronic
1144766752 17:17737419-17737441 AGGCCAGGGTTTTGGGCCAGGGG - Intronic
1144830832 17:18130402-18130424 AGGTAAGGGGTTGGGGGGTGGGG + Intronic
1144891009 17:18494385-18494407 GGGCCGGGGGCTGGGGTGTGGGG + Exonic
1144932007 17:18867095-18867117 AGACATGGGGTTGGGGTGAGGGG + Intronic
1145141214 17:20449933-20449955 GGGCCGGGGGCTGGGGTGTGGGG - Exonic
1145786526 17:27597383-27597405 AGGTGAGGGGTTGGGGGGCGTGG - Exonic
1145794706 17:27649000-27649022 GGGCCGGGGGCTGGGGTGTGGGG + Exonic
1145892992 17:28431287-28431309 CTGCCGGGGGTTGGGCTGAGAGG - Intergenic
1145980701 17:29009742-29009764 TGGGCAGGGGTTGGGGTGTCTGG - Intronic
1146151617 17:30477677-30477699 GGGGCAGGGGTTGGGCAGAGTGG + Intronic
1146517272 17:33498975-33498997 AGACGAGGAGTTGGGGTGATGGG + Intronic
1146547557 17:33751929-33751951 AAGCCGGGGGTGGGGGTGAGGGG + Intronic
1146892265 17:36513790-36513812 AGGCATGGGGTTGGGATAAGAGG + Intronic
1146971554 17:37076845-37076867 TTGCCAGGGGTCGGAGTGAGGGG - Intergenic
1146973688 17:37093141-37093163 AGGCCAGGTTTTGAGGTCAGTGG + Intronic
1147311697 17:39599479-39599501 AAGCGAGGGGTGGGGGTGGGGGG - Intergenic
1147324824 17:39665197-39665219 AGGGCAGGGGTTGGGGTACCTGG - Exonic
1147338945 17:39742604-39742626 AGGGAAGGGGTTGGGGATAGAGG - Exonic
1147387567 17:40091110-40091132 GGGGCAGGGGGTGGGGGGAGGGG + Intronic
1147443317 17:40460576-40460598 AGGTGGGGGGTGGGGGTGAGGGG - Intergenic
1147465620 17:40608592-40608614 ATGCCAGGGGTTGGGGTGGGGGG - Intergenic
1147506532 17:41023207-41023229 TTGCCAGGGGTTGGGGTAAAAGG - Intergenic
1147560732 17:41507342-41507364 AGGCCAGGGGCTGGGTGGGGTGG + Intergenic
1147660018 17:42112437-42112459 TGGCCAGGAGTTGGGATGAGTGG - Intronic
1148131191 17:45263519-45263541 AAGCCAGGAGATGGGGTGAAGGG - Exonic
1148251047 17:46080708-46080730 AAGACAGGGGTTGGGGGGTGGGG - Intronic
1148337962 17:46853990-46854012 AGGCCTGGGTTAGGGCTGAGAGG + Intronic
1148437195 17:47694029-47694051 AGGGAGGGGGTTGGGGGGAGGGG + Intergenic
1148555489 17:48576651-48576673 AGTGCAGGGGATGGGGTGGGGGG - Exonic
1148559080 17:48595692-48595714 AGGCTGGGGGTTGAGGAGAGAGG + Intronic
1148577692 17:48723120-48723142 AGGCCAGTGCCTGGGGGGAGGGG + Intergenic
1148649391 17:49238821-49238843 AGGGCAGGTGGAGGGGTGAGAGG - Intergenic
1148871833 17:50662990-50663012 AGGCCAGGGCTCGGGGGCAGGGG + Intronic
1149202188 17:54199847-54199869 ATGGCAGGGGTTGGGGGGAAAGG - Intergenic
1149205920 17:54247740-54247762 AGGCCATGGATAGGGGTGTGGGG + Intergenic
1149346902 17:55748032-55748054 AGGCCAGGGGATGGGATGGGTGG - Intergenic
1149545879 17:57503655-57503677 AGTCCTGGGTCTGGGGTGAGGGG + Intronic
1149849924 17:60028251-60028273 AGGGCTGGGGTTTGGGGGAGAGG + Intergenic
1149860244 17:60118273-60118295 AGGGCTGGGGTTTGGGGGAGAGG - Intergenic
1150280995 17:63929550-63929572 GGGCCAGGGAGAGGGGTGAGGGG + Intronic
1151646539 17:75436357-75436379 AGGTGAGGGGATGGGGTCAGGGG - Intergenic
1151647930 17:75446374-75446396 TTGCCAGGGGCTGGGGTGTGGGG - Intronic
1151743694 17:76000709-76000731 GGCCCAGGGGCTGGGGTGGGGGG + Intronic
1151843526 17:76634635-76634657 AGGCCGGGGGTGGGGGTGGGGGG + Intronic
1151919060 17:77140584-77140606 AGGGGAGGGGTTCGGCTGAGCGG - Intronic
1152019512 17:77773021-77773043 TGGAGAGGGGTTGGGGAGAGTGG - Intergenic
1152126767 17:78451745-78451767 TGGCCTGGGGCTGGGGTGAAAGG - Intronic
1152167533 17:78720079-78720101 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
1152220850 17:79064674-79064696 GAGGCAGGGGTTGCGGTGAGTGG + Intergenic
1152286923 17:79418044-79418066 ATGCCAGGGGCTGGGGAGATAGG + Intronic
1152313994 17:79569242-79569264 TTGCCAGGGCTTGGGGGGAGTGG - Intergenic
1152351899 17:79788829-79788851 ATGGCAGGGGTTGGGGGCAGGGG + Intergenic
1152353404 17:79795459-79795481 AGGCCAGGTCCTGGGGCGAGCGG + Exonic
1152361605 17:79835565-79835587 AGGCCTGGGGATGGGGGGGGTGG - Intronic
1152516611 17:80828539-80828561 AAGGCAGGGGTCGGGGTTAGGGG - Intronic
1152649595 17:81486199-81486221 AGGCCAGGGGCTGGGGAGAGAGG - Intergenic
1152649605 17:81486225-81486247 TTGCCAGGGGTTGGGGGGAGAGG - Intergenic
1152733816 17:81987033-81987055 AAGCCACGGGCAGGGGTGAGCGG + Intronic
1152733830 17:81987095-81987117 AAGCCACGGGCAGGGGTGAGCGG + Intronic
1152733844 17:81987157-81987179 AAGCCACGGGCAGGGGTGAGCGG + Intronic
1152733858 17:81987219-81987241 AAGCCACGGGCAGGGGTGAGCGG + Intronic
1152782574 17:82232755-82232777 AGGCCTGGGGCAGGGGTGGGTGG - Intronic
1152810999 17:82382868-82382890 AGGGCAGGGCCTGGGGTGGGAGG - Intergenic
1152958686 18:63862-63884 AGGGCTAGGGTTGGGGTCAGTGG - Intronic
1153820778 18:8829641-8829663 AGGCCAGTGGATGAGGTGGGTGG - Intronic
1154315664 18:13301418-13301440 AGGCTGGGGCTTGGGGCGAGGGG + Intronic
1155025716 18:21938737-21938759 TGACCAGGGGCTGGGGGGAGGGG + Intergenic
1155075008 18:22346982-22347004 CGGCCAGGGGGAGGGGAGAGAGG - Intergenic
1155190780 18:23428013-23428035 CTGCCATGGGTTGGGGGGAGAGG + Intronic
1155459417 18:26060376-26060398 TTGCCAGGGGATGGGGAGAGGGG + Intronic
1155506130 18:26535096-26535118 AGGCCTGGGGTTGGGGGGTGGGG + Intronic
1155510668 18:26573240-26573262 ATGCCAGAGGCTGGGGGGAGGGG + Intronic
1155531432 18:26770871-26770893 AGGCCAGGGGCAGGGGTTCGGGG + Intergenic
1156066558 18:33148910-33148932 CATGCAGGGGTTGGGGTGAGGGG - Intronic
1156552309 18:38030366-38030388 GGGGCAGGGGTGGTGGTGAGTGG + Intergenic
1156587138 18:38443908-38443930 AGGTCAGGGCCTGTGGTGAGAGG + Intergenic
1156709090 18:39920109-39920131 TGTCATGGGGTTGGGGTGAGGGG - Intergenic
1157162225 18:45324547-45324569 GCCCCAGGGGGTGGGGTGAGGGG - Intronic
1157196888 18:45626814-45626836 AGGCCAGGGGTCGGGGTGGAGGG - Intronic
1157405982 18:47423173-47423195 AGACCAAGGTTTGGGGGGAGGGG + Intergenic
1157860123 18:51133709-51133731 GGGGCAGGGGTTGGGCAGAGTGG + Intergenic
1158565658 18:58552214-58552236 AGAACTGGGGTTGGGGTGGGAGG - Intronic
1158566562 18:58559231-58559253 ACAACTGGGGTTGGGGTGAGGGG + Intronic
1158624241 18:59057769-59057791 AGGCCCCGGGTTGGGGAGGGTGG - Intergenic
1158650056 18:59276157-59276179 AGGGCAGGGGTGGTGGTGATGGG + Intronic
1158969893 18:62656555-62656577 GAGGCAGAGGTTGGGGTGAGCGG + Intergenic
1159010053 18:63050555-63050577 AGGTCTGGGGTAGGGGTGAAGGG - Intergenic
1159164058 18:64680980-64681002 AGACCAGAGGTTAGGGGGAGGGG - Intergenic
1159364164 18:67444881-67444903 CTGTCAGGGGTTGGGGTGGGAGG - Intergenic
1160113628 18:76057116-76057138 AGGCCCGGGGTTGGCTTGACTGG - Intergenic
1160170971 18:76554077-76554099 AGGCTAGGGGTGGGGAGGAGAGG + Intergenic
1160197455 18:76767778-76767800 TTGCCAGGGGTTGGTGGGAGGGG - Intergenic
1160657741 19:281978-282000 AGGACTGGGGTTGGGGGAAGGGG + Intronic
1160724270 19:610668-610690 AGGGCAGGGGGTGGGGAGGGAGG + Intronic
1160725856 19:617512-617534 AGGCCAGGTTTTGGGGTGGGGGG + Intronic
1160934132 19:1585251-1585273 AGGCCTGGGTTTGGGGTCTGGGG - Intronic
1160947044 19:1648490-1648512 AGACCAGCGTTTGGGGGGAGGGG - Intronic
1161007335 19:1943086-1943108 GGGCCAGGTCTGGGGGTGAGAGG + Intronic
1161088391 19:2345408-2345430 AGGGTTGGGGTTGGGGTTAGGGG - Intronic
1161204531 19:3034170-3034192 AGGCCAGGTGTTGGGAATAGAGG - Intronic
1161314852 19:3613019-3613041 AGGCCAGGGGGTGGGGCCAGTGG - Intronic
1161412137 19:4122935-4122957 AGGGGAGAGGATGGGGTGAGGGG - Intronic
1161968383 19:7561582-7561604 AGTCCAGGGGTGGGAGGGAGGGG - Exonic
1161984589 19:7646621-7646643 AGGCCAGGGCTGGGGCTCAGGGG - Intronic
1162027187 19:7901008-7901030 AGGCCAGGAGATGGGGGGGGCGG + Exonic
1162050314 19:8028790-8028812 AGGCCTGGGGTTGGGGGGTGTGG + Intronic
1162130315 19:8522343-8522365 AGGGCAGAAGCTGGGGTGAGGGG - Intronic
1162174925 19:8823533-8823555 AGGGCAGGAGTTGGGGTAACAGG - Intronic
1162361639 19:10223965-10223987 AGGCCGGGGGTGGGGGTGCAAGG - Exonic
1162483803 19:10946065-10946087 AGGCCAAGGGGTGGGGGGGGGGG + Intergenic
1162701264 19:12516759-12516781 ACTCAAGGGGTTGGGGTGGGAGG - Intronic
1162758068 19:12872313-12872335 AGTACAGGGATTTGGGTGAGAGG + Intronic
1162806486 19:13140255-13140277 AGGCCAGGAGGCGGGGGGAGAGG - Exonic
1162976458 19:14209383-14209405 GGGCGAGGGGCGGGGGTGAGGGG - Intergenic
1163085785 19:14979238-14979260 AGGCCACGGGTTGGGGAGGTGGG + Intronic
1163206961 19:15810645-15810667 TTTCCAGGGGCTGGGGTGAGGGG + Intergenic
1163456650 19:17410277-17410299 ACGCCAGAGGCTGAGGTGAGAGG - Intronic
1163476364 19:17528437-17528459 AGGGCAGGGGTTCAGGTGGGAGG + Intronic
1163500158 19:17671444-17671466 AGGCCAGGGATTGGGCTGTGGGG + Intronic
1163676523 19:18658101-18658123 TGGCCAGGGGTGGGGGTGGCGGG + Intronic
1163719946 19:18894225-18894247 AAGGCAGGGGTTGGGGAGTGCGG + Intronic
1163816852 19:19471507-19471529 AGGACAGGGCTGGGGGTGGGTGG + Intronic
1164270300 19:23666807-23666829 TGGCCCTGGGTTGGGGGGAGGGG - Intronic
1164294773 19:23900263-23900285 AGGCAAGGGCTTGGTTTGAGAGG - Intergenic
1164468255 19:28506409-28506431 GGGCAGGGGGCTGGGGTGAGGGG - Intergenic
1164563473 19:29309849-29309871 AGGGTAGGGGCTGGGGAGAGCGG - Intergenic
1164754564 19:30680005-30680027 AGGCCAGGGGAGGGAGGGAGGGG + Intronic
1164780761 19:30890011-30890033 TTGCCAGGGGTTGAGGGGAGAGG + Intergenic
1165141863 19:33704467-33704489 GGGAAAGGGGATGGGGTGAGGGG + Intronic
1165153479 19:33774040-33774062 GGGCCAGGGATCAGGGTGAGTGG - Intergenic
1165157012 19:33795406-33795428 CGGCCTGGAGCTGGGGTGAGGGG - Intergenic
1165245886 19:34498151-34498173 GGGCCAGGTGTTGGTGTCAGGGG + Intronic
1165386261 19:35512307-35512329 AGTGGAGGGATTGGGGTGAGAGG - Intronic
1165426157 19:35746548-35746570 AGGCCAGTGGCAGGGGAGAGGGG + Intronic
1165467455 19:35983506-35983528 AGGGCAGGGGTCGAGGTGGGGGG - Intergenic
1165700419 19:37933132-37933154 GGGCCTGGGGTTGGGGAGGGGGG - Intronic
1165711260 19:38012492-38012514 AGGCCAGAGTGTGGGGTGAGGGG + Intronic
1165767280 19:38359406-38359428 AGGCCTGGGATTGGGGGAAGCGG + Intronic
1165816197 19:38643860-38643882 AGACAAGTGGTGGGGGTGAGGGG - Intergenic
1166094070 19:40528989-40529011 AGGCCCCGGGTTGGGGGGTGCGG - Intronic
1166667515 19:44689823-44689845 AGACCAGGGGTGAAGGTGAGAGG - Intergenic
1166688560 19:44809856-44809878 AGGCCGGGGGCTGGGGGGTGGGG + Intronic
1166749850 19:45159518-45159540 AGGCCAGGGATTTGGGTGGGGGG + Intronic
1166762758 19:45235011-45235033 AGGGGAGGGGTCAGGGTGAGGGG + Intronic
1166887908 19:45973037-45973059 AGGAGAGGGGTGGGGGGGAGGGG - Intronic
1166995245 19:46716893-46716915 CGGCCAGGGGATGGGCAGAGGGG + Exonic
1167172966 19:47845706-47845728 CTGCCAGGGGCTGGGGTGAGGGG + Intergenic
1167323978 19:48812882-48812904 AGGCCTGGGGTTGGGGGGCGGGG + Intergenic
1167359028 19:49020161-49020183 AGGTCAGAGTTTGGGGTGGGGGG - Intergenic
1167366711 19:49058398-49058420 AGGTCAGAGTTTGGGGTGGGGGG - Exonic
1167456831 19:49600793-49600815 AAGGCAGAGGTTGCGGTGAGCGG - Intronic
1167591438 19:50406537-50406559 AGGTCAGAGGTTGGGGTGAGAGG - Intronic
1167640626 19:50679214-50679236 AGGCAAGGGGTCAGGGTGACGGG + Intronic
1167831159 19:52023908-52023930 AGGTCAGGGGTTGGTTGGAGAGG - Intronic
1167861345 19:52286414-52286436 AGGCATGTGGTTGAGGTGAGAGG - Intronic
1168132705 19:54331556-54331578 AGCCCAGGGGCTGGAGTAAGAGG + Intergenic
1168165289 19:54543098-54543120 AGGGGAGGGGTTGGGGTGATTGG - Intronic
1168260007 19:55188004-55188026 TGGCCAGGGGGTGGGGGGTGGGG + Intronic
1168269604 19:55242291-55242313 GGGGCAGGGGTCAGGGTGAGGGG + Intronic
1168293422 19:55368161-55368183 GGGCCAGGGGTGGGGGTCTGGGG + Intronic
1168316918 19:55488557-55488579 AGGGCAGGGGATGGGGTGAAAGG - Exonic
1168408692 19:56124732-56124754 GTGCCAGGGGCTGGGGGGAGGGG + Intergenic
1168421215 19:56205060-56205082 TTGCCAGGGGCTGGGGTGGGTGG + Intronic
925128252 2:1476920-1476942 AGGCCGGGGGGGGAGGTGAGGGG + Intronic
925242089 2:2340216-2340238 AGGCCAGGGTTTGGGGTGAAGGG - Intergenic
925538187 2:4938472-4938494 GGGGCAGGGGATGGGGAGAGTGG + Intergenic
925957686 2:8984224-8984246 AGGCCAGGGGTTGGGGTGAGGGG + Intronic
926116909 2:10219103-10219125 TGGCCAGAGGTTGGGGTTTGGGG + Intergenic
926363249 2:12109954-12109976 TTGCTAGGGGTTGGGGTGGGTGG + Intergenic
926688795 2:15718539-15718561 AGGCCAGCAGGTGGGGTGAAAGG - Intronic
926780021 2:16461984-16462006 AGCCAAGGGGCTGGAGTGAGAGG + Intergenic
927146928 2:20172376-20172398 AGGCCTGGGGCTGGGGTTGGAGG - Intergenic
927259915 2:21078051-21078073 AGGAAAGGGGTTGGGGTAATGGG - Intergenic
927401609 2:22718792-22718814 TGGTAAGGGGTAGGGGTGAGTGG + Intergenic
927500079 2:23576852-23576874 GGGCCAGAGGTGGGTGTGAGTGG - Intronic
927567895 2:24129958-24129980 AGTCGAGGGCTGGGGGTGAGGGG - Intronic
927806875 2:26155814-26155836 TGGCCAGGGGCTGGGGGGAAGGG + Intergenic
928016950 2:27666366-27666388 AGGCCGGGGGGCGGGGTGGGGGG - Intronic
928137309 2:28697406-28697428 TGGCCAGGTATTGGGGGGAGGGG + Intergenic
928173049 2:29015746-29015768 CAGCCAGGGATAGGGGTGAGGGG + Intronic
928362713 2:30678670-30678692 AGGGCGGGGGTTGTGGTGAGAGG - Intergenic
928980471 2:37131150-37131172 AGGTCTGGGGTAGGAGTGAGTGG - Intronic
928996936 2:37303023-37303045 AGGACAGGGGTTGGGCCGTGGGG - Intronic
929139062 2:38651468-38651490 AGGCCAGGGGCTGGGCACAGTGG + Intergenic
929766371 2:44847281-44847303 TTGCCAGGGGCTGGGGCGAGGGG - Intergenic
929767433 2:44858388-44858410 AGGGCTGGGGGAGGGGTGAGAGG + Intergenic
929822036 2:45281682-45281704 GGGCCCTGGGTTAGGGTGAGAGG - Intergenic
929886614 2:45884186-45884208 CAGCCAGGAGGTGGGGTGAGAGG + Intronic
930219670 2:48733633-48733655 GGGCCAGGGAATGGGGAGAGAGG + Intronic
930794123 2:55369698-55369720 GGGCCAGGGGTGGTGGTGGGTGG - Intronic
931586230 2:63832413-63832435 ACTCCAGGTGTTGGGGTGGGGGG + Intergenic
931906168 2:66846190-66846212 AAGGCAGTGGTGGGGGTGAGGGG + Intergenic
932164132 2:69490642-69490664 TTGCCAGGGGCTGGGGGGAGGGG + Intronic
932488471 2:72103307-72103329 AGGCTAGGGGATGGGGCTAGGGG + Intergenic
932588238 2:73045533-73045555 TGGCGGGGGGTGGGGGTGAGGGG + Intronic
932668135 2:73713742-73713764 TTGCCAGGGATTGGGGAGAGAGG - Intergenic
932791074 2:74654720-74654742 AGGCCCGGGCTGGGGATGAGGGG - Intronic
933572130 2:84026124-84026146 AGGAGAGGGTCTGGGGTGAGGGG - Intergenic
933645052 2:84805355-84805377 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
933679409 2:85086372-85086394 TTGCCAGGGATTGGGGTGAGAGG - Intergenic
933777038 2:85777335-85777357 AGGGCAGGGGTTGGGGTATCAGG + Intronic
933990537 2:87631064-87631086 TTGCCAGGGGCTGGGGAGAGGGG + Intergenic
934113805 2:88765562-88765584 AGCCCAGGGATGGGGTTGAGTGG - Intergenic
934636221 2:95992109-95992131 AGCCCAGGGATGGGGTTGAGTGG + Intergenic
934665764 2:96169091-96169113 CTGCCAGGGGCTGGGGAGAGAGG + Intergenic
934691655 2:96365395-96365417 CGGGCAGGGGGTGGGGTGGGGGG - Intronic
934797429 2:97113317-97113339 AGCCCAGGGATGGGGTTGAGTGG - Intergenic
934835983 2:97590122-97590144 AGCCCAGGGATGGGGTTGAGTGG + Intergenic
934856725 2:97734471-97734493 AGGTCAGGGGCAGGGGTGTGGGG - Intronic
935111223 2:100096081-100096103 AGGGCTGGGGTTGGGGGGATGGG - Intronic
935650366 2:105376999-105377021 TTGCCAGGGGCTGGGATGAGAGG + Intronic
936073140 2:109384495-109384517 AGGAGAGGGGTTGGGGTCAGAGG + Intronic
936123747 2:109769083-109769105 AGGGCTGGGGTTGGGGGGATAGG + Intergenic
936152535 2:110029721-110029743 AGGACGGGTGTTGGGGGGAGGGG - Intergenic
936192145 2:110341691-110341713 AGGACGGGTGTTGGGGGGAGGGG + Intergenic
936220939 2:110602383-110602405 AGGGCTGGGGTTGGGGGGATAGG - Intergenic
936303309 2:111319760-111319782 TTGCCAGGGGCTGGGGAGAGGGG - Intergenic
936569618 2:113602987-113603009 AGGGTGGGGGTTGGGGTTAGGGG - Intergenic
936569706 2:113603253-113603275 GGGGCTGGGGTTGGGGTTAGGGG - Intergenic
936569756 2:113603380-113603402 AGGGTAGGGGTTAGGGTTAGGGG - Intergenic
936571880 2:113624590-113624612 GGGTTAGGGGTTGGGGTTAGGGG - Intergenic
936571893 2:113624623-113624645 AGGTCAGGGGTTAGGGTTAGGGG - Intergenic
936972996 2:118192505-118192527 AGGCCATGGGGTTGGGGGAGCGG + Intergenic
937230429 2:120395334-120395356 AGGCCAGGGAGTAGGGTGTGGGG + Intergenic
937261358 2:120588442-120588464 AGGCCAGGGAGGGGGGTGTGTGG + Intergenic
937286277 2:120754434-120754456 AGGCCAGGGGGTGGGGTGGGGGG - Intronic
937721813 2:125107164-125107186 AGGCTGGGGGTGGGGGTGAATGG - Intergenic
937854687 2:126663753-126663775 AGGTCAGGGGCTGAGCTGAGAGG - Intronic
938063666 2:128269891-128269913 TGGGCAGGGGTGGGGGTGGGGGG + Intronic
938539772 2:132276188-132276210 AGGCTGGGGGTGGGGGTGGGGGG + Intergenic
939165657 2:138638712-138638734 TTGCCAGGGGTTGGGGGCAGAGG + Intergenic
939365964 2:141231602-141231624 GGGGCAGGGGTGGGGGTGGGGGG - Intronic
939382761 2:141457429-141457451 GTGCCAGTGGGTGGGGTGAGGGG + Intronic
939412934 2:141855068-141855090 AGGCAAGGTGTTGGGGTGCTAGG + Intronic
940337342 2:152543269-152543291 AGGCCAGGGGCAGGGGTTGGGGG - Intronic
940970958 2:159896338-159896360 AGGATAGGAGTTGGGGTGAGAGG + Intronic
941990106 2:171547350-171547372 AGTCAAGAGGTTTGGGTGAGAGG + Intronic
942173897 2:173312812-173312834 AGGCCTGGGGTGGGGCTGGGGGG - Intergenic
942427265 2:175873177-175873199 AGGCCAGGTGATGGGGACAGTGG - Intergenic
942801830 2:179884180-179884202 AGGGCAGGGGTGGGAGTGTGGGG + Intergenic
943363043 2:186944531-186944553 AGTCTAGAGGTTGGGGTCAGGGG - Intergenic
944310372 2:198226230-198226252 TTGCCAGGGGCTGGGGGGAGAGG + Intronic
944933372 2:204543585-204543607 AAGCCAGGACTTGGGGTGGGAGG + Intergenic
945092660 2:206190091-206190113 ATGCCAGGGGTTGGAGTGTGAGG - Intronic
945100223 2:206256628-206256650 AGGCCAGGGGTTGGGGGGTTGGG + Intergenic
945257272 2:207813189-207813211 AGGGCGGGGGTGGGGGTGGGGGG - Intergenic
945441226 2:209882319-209882341 AGGCCAGGCGGTGTGGGGAGAGG + Intronic
945462699 2:210128575-210128597 TTGCCAGGGGTTGAGGAGAGAGG + Intronic
945696108 2:213106524-213106546 AGTCCAGAGGCTGAGGTGAGAGG + Intronic
945747099 2:213731626-213731648 AGGGCAGGGGGTGGGAAGAGGGG - Intronic
945806050 2:214491018-214491040 TTGCCAGGGGATGGGGGGAGTGG + Intronic
946031820 2:216711422-216711444 AGGGAAGTGGGTGGGGTGAGAGG - Intergenic
946153408 2:217791272-217791294 GGGTCTGGGGTTGGGGTGGGTGG - Intergenic
946161855 2:217840328-217840350 AGGCCAGGGGTAGATGTTAGTGG + Intronic
946193668 2:218021100-218021122 GGGCAAGGGGCTGGGGTCAGCGG - Intergenic
946199778 2:218064868-218064890 AGGGGAGGGGATGGGGTTAGGGG - Intronic
946278370 2:218647757-218647779 AGGGAAGGGGTCTGGGTGAGTGG - Intronic
947593372 2:231396878-231396900 TGGACCGGGGTTGGGGTGGGGGG + Intronic
947677816 2:232000415-232000437 AGGCTGGGGGTTGAGGGGAGAGG - Intronic
947742128 2:232489503-232489525 AGTCCCGGGGGTGGGGTGGGGGG + Intergenic
947753373 2:232544295-232544317 AAGCCAGAGGTTGGCGTGAAGGG - Intronic
947766864 2:232643528-232643550 TAGCCAGGTGTTGGGGTGCGGGG - Intronic
948058889 2:235029296-235029318 AGGCCAGGGGCAGGGGTTTGGGG + Intronic
948196827 2:236103009-236103031 AGGCCAGGCCTGGGGGTGGGGGG - Intronic
948331689 2:237172320-237172342 AGCCCTGGGGATGGGGAGAGGGG - Intergenic
948336694 2:237213939-237213961 AGGCCATTGGTTGGGGCGGGGGG + Intergenic
948464041 2:238143694-238143716 AGGCCAGCTGTTCGGGTCAGGGG + Intronic
948540254 2:238686156-238686178 AGCCGAGAGGATGGGGTGAGAGG + Intergenic
948544403 2:238716802-238716824 AGGGTTGGGGGTGGGGTGAGAGG + Intergenic
948588577 2:239035944-239035966 CAGCCAGGGGTTAGGGTCAGGGG + Intergenic
948811524 2:240480856-240480878 AGGCCTGGGGTGCTGGTGAGGGG - Intronic
948930439 2:241128452-241128474 AGGCCAGTGGCTGGGCTGACAGG - Intronic
948934083 2:241150792-241150814 AGGCCGGGGGTGGGGCTGAATGG + Intronic
1168819140 20:761641-761663 AGGCCTTGGCTAGGGGTGAGGGG + Intronic
1168894846 20:1317069-1317091 ATGCCAGGGGTTAGGGAGGGTGG + Intronic
1168897867 20:1336416-1336438 AGACCAGGGTTTGGGGTCACTGG - Intronic
1168988857 20:2077174-2077196 TTGCCAGGGGTTGGGGGGAAAGG + Intergenic
1169220924 20:3822298-3822320 AGGCCTGGGGCTGGGCTGTGTGG - Intronic
1169499881 20:6148781-6148803 TGGCCAGGAGCTGGGTTGAGGGG + Intergenic
1169832435 20:9839072-9839094 CGGCCGGGGGTGGAGGTGAGGGG + Intergenic
1170221887 20:13950153-13950175 TTGCCAGGGGCTGGGGTGAGAGG + Intronic
1170289371 20:14751195-14751217 AGGCCAAGGGTGGGGCTGGGAGG - Intronic
1170747279 20:19111455-19111477 AAGCCAGTGGGTGGGGAGAGAGG + Intergenic
1170801940 20:19597719-19597741 TGGGCAGGGTGTGGGGTGAGGGG - Intronic
1171137380 20:22708741-22708763 AGGCCAGGGATGTGGGTGCGAGG + Intergenic
1171461856 20:25302494-25302516 AGGCCCGGGGGTGGGCTGGGAGG + Intronic
1171522968 20:25789477-25789499 GTGGCAGGGGTTGCGGTGAGTGG - Intronic
1171553859 20:26066406-26066428 GTGGCAGGGGTTGCGGTGAGTGG + Intergenic
1171986111 20:31662292-31662314 ATGACAGAGGGTGGGGTGAGAGG - Intergenic
1172022437 20:31924141-31924163 AGGCCCGGGGTGGAGGTGAGAGG - Intronic
1172058091 20:32168127-32168149 AGGCTTGGGGTTGGGGTGGCGGG - Intergenic
1172177344 20:32980394-32980416 AGTCCAGTGGGTGGGCTGAGTGG + Intergenic
1172306503 20:33884539-33884561 AGGCCATGGGATGTGGTAAGAGG - Intergenic
1172779121 20:37425259-37425281 AGGCCAGGGGTGGCGGAGGGTGG + Intergenic
1172793315 20:37520932-37520954 AGGCCAGGGACTGGGGAGAAGGG + Intronic
1173186234 20:40842663-40842685 ATGCCAGGGGTTGGGAAAAGGGG + Intergenic
1173553747 20:43950968-43950990 AGGCTAGATTTTGGGGTGAGGGG + Intronic
1173681100 20:44882628-44882650 TTGCCAAAGGTTGGGGTGAGGGG + Intergenic
1173718868 20:45235909-45235931 AGGCCAGGGGCTTGTTTGAGTGG + Intergenic
1173828391 20:46062256-46062278 AGGCCAGGGGATGAGGGGACTGG + Exonic
1174541742 20:51295200-51295222 TGGCCAGAGGCTGGGGTGAGGGG + Intergenic
1174787316 20:53444864-53444886 GAGCCAGGGGTTGGGCTGGGGGG - Intronic
1175793375 20:61756529-61756551 GGTCCAGGGGATGGGGTGATGGG - Intronic
1175874981 20:62225110-62225132 CAGCCAGGGGCTGGGATGAGAGG + Intergenic
1176024924 20:62981035-62981057 AGGCACGGGGTGGGGGTGACAGG + Intergenic
1176138766 20:63536150-63536172 AGGCCAGGTGGGGGGGGGAGCGG - Intronic
1176414013 21:6464550-6464572 CGGCCAGCGGCTGAGGTGAGTGG + Intergenic
1177031464 21:15985088-15985110 AGGGCAGGGGTGGGGGTCACAGG + Intergenic
1177779419 21:25607182-25607204 AGGGCAGGGGTCGGGGCCAGGGG - Intronic
1177891179 21:26805702-26805724 AGGCCTGGAGTGGAGGTGAGGGG + Intergenic
1177897927 21:26876174-26876196 TTGCTAGGTGTTGGGGTGAGGGG + Intergenic
1178015882 21:28345756-28345778 GGGCCGGGGGTGGGGGTGCGGGG - Intergenic
1178319015 21:31590825-31590847 AGGCCAAGGGGTGGGGGGCGGGG + Intergenic
1178468100 21:32867154-32867176 TAGCCAGGGGTTGGGTAGAGGGG - Intergenic
1178480784 21:32977984-32978006 AGGCCAGCGAATGGGGTGAAGGG + Intergenic
1178809699 21:35870248-35870270 AGGTCAGGGGTTGGGGAGAGTGG - Intronic
1178924326 21:36762346-36762368 AGAGCAGGGGTAGGGGTGTGTGG + Intronic
1178941771 21:36912756-36912778 ATGGCAGGGGTTGGGGGGGGTGG - Intronic
1178949551 21:36974968-36974990 AGGCCAGAAGTTGGGGGCAGAGG - Intronic
1179048524 21:37868786-37868808 AGGGCTGGGGTTGGGTGGAGAGG + Intronic
1179243832 21:39613071-39613093 AGGCCCGGGGCTGGGGCGCGGGG + Intronic
1179363008 21:40730277-40730299 AAGTTTGGGGTTGGGGTGAGTGG + Intronic
1179424767 21:41267014-41267036 AGCCTAAGGGTTGGGGTGGGGGG + Intronic
1179689511 21:43072872-43072894 CGGCCAGCGGCTGAGGTGAGTGG + Intronic
1179831839 21:44001743-44001765 GTGCCAGGGGTTGGCGTGAAAGG + Intergenic
1179984710 21:44913991-44914013 AGCTCAGGGGCTGGGGTGGGGGG - Intronic
1180019468 21:45112474-45112496 GGGCCAGGGCTTGGGGTCGGGGG + Intronic
1180595483 22:16970210-16970232 AGGGAAGGGGCAGGGGTGAGAGG + Intronic
1180623954 22:17181609-17181631 AGGGCAGGGGTTGGGGAACGGGG + Intronic
1180801245 22:18632935-18632957 ATGGCAGGGGTTGGGGGGAGAGG + Intergenic
1180841645 22:18961703-18961725 AGGTGAGAGGTAGGGGTGAGAGG - Intergenic
1180909279 22:19437437-19437459 AGGTATGGGGTTGGGGGGAGTGG + Intronic
1180911923 22:19456688-19456710 TAGCCGGGGGTGGGGGTGAGAGG - Intronic
1180945898 22:19693245-19693267 TTGCCAGGGGTTGGGGGCAGGGG - Intergenic
1180988319 22:19918564-19918586 AGGCCAGGAGTGCGGGTGGGAGG - Intronic
1180989570 22:19926862-19926884 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
1181163878 22:20973445-20973467 AGGGCTGGGGTAGGGGTGAGGGG - Exonic
1181220476 22:21362326-21362348 ATGGCAGGGGTTGGGGGGAGAGG - Intergenic
1181269051 22:21648178-21648200 AAGCCTTGGGGTGGGGTGAGGGG + Intergenic
1181316690 22:21975137-21975159 TGGCCAGAGTTGGGGGTGAGTGG + Intronic
1181381668 22:22509108-22509130 CAGCCAGGGCTTGGGGTGGGGGG + Exonic
1181441114 22:22935604-22935626 AGGCCAAGGGATGGGGTTGGGGG + Intergenic
1181527044 22:23496017-23496039 AGTGCAGGGGTGGGGGTGACAGG - Intergenic
1181537854 22:23555982-23556004 AGTCCGGGGGTGGGGGTGGGGGG + Intergenic
1181581852 22:23833020-23833042 CGGCCAGGAGGTGGGCTGAGGGG + Intronic
1181893581 22:26086263-26086285 GGACCAGGGGTGGGGGTGAAGGG + Intergenic
1181985974 22:26800057-26800079 AGACTGGGGGTTGGGGTGGGAGG + Intergenic
1182111197 22:27725025-27725047 AGGCCAGGGTTTGGCATGAAAGG + Intergenic
1182280622 22:29216098-29216120 AGCCCAGGGGTGGGGGGGCGGGG - Intronic
1182299685 22:29330586-29330608 AGGCGAGGGGCTGGGGTCGGGGG + Intronic
1182419370 22:30241515-30241537 AGGCCTGGGGTTGGGGTGGAGGG - Exonic
1182477801 22:30585698-30585720 TGGTCAGGGGTTGGGGGGAGTGG + Intronic
1182569372 22:31225119-31225141 AGGCTGGGGGTTGGGGGGCGGGG - Intronic
1182821705 22:33222277-33222299 CAGCCAGGGTTAGGGGTGAGGGG + Intronic
1183128234 22:35805959-35805981 TTGCCAGGGGTTGGGTTGTGGGG + Intronic
1183314365 22:37128861-37128883 AGGCCAGGGGTGGGTGAGTGGGG + Intronic
1183332446 22:37228776-37228798 AGGCCAGGTGCTGGGGAGAAAGG + Intronic
1183383649 22:37502980-37503002 AGGACTGGGCTCGGGGTGAGAGG + Intronic
1183489056 22:38107194-38107216 AGTCCAGGGGGAGGGGTGACTGG + Intronic
1183612695 22:38921273-38921295 AGCCCAGGTGATGGGGTGTGAGG + Intergenic
1183880368 22:40822072-40822094 AGGCCAGGGGGTGGGGGGGGGGG - Intergenic
1184096687 22:42319916-42319938 AGACCAGGTGCTGGGGTGGGAGG - Intronic
1184230626 22:43156529-43156551 CGGCCAGGGGTGGGAGGGAGGGG + Intronic
1184348327 22:43926300-43926322 TGGCCAGGGGTTGGGCTGGGAGG + Intronic
1184406130 22:44301896-44301918 ATGCCAGGGGCTTGGGGGAGGGG + Intronic
1184611876 22:45609215-45609237 AGGAGTGGGGTAGGGGTGAGAGG + Intergenic
1184647035 22:45901778-45901800 CTGCCAGGGGTTGGGGCGGGAGG + Intergenic
1184831331 22:46990655-46990677 AGCCCAGGGGTTGGGTGGAAGGG - Intronic
1184849924 22:47114235-47114257 CGGCCAGGGTGTGGGGTGTGGGG + Intronic
1184986622 22:48140364-48140386 GAGCCAGGGGTGGGAGTGAGAGG + Intergenic
1185149126 22:49154200-49154222 AGGCCAGGGCCTGGGGAGGGTGG + Intergenic
1185299424 22:50071888-50071910 CAGCCAGGGGCTGTGGTGAGAGG + Intronic
1185419881 22:50729308-50729330 AGCACAGAGGTTGGGGTGGGGGG + Intergenic
1185420346 22:50731357-50731379 CGGCCCGGGGTGGGGGTGGGGGG - Intergenic
1185428315 22:50786294-50786316 GGGTTAGGGGTTGGGGTTAGGGG + Intergenic
949334873 3:2963473-2963495 AGGCCAGTGGGATGGGTGAGTGG - Intronic
949560549 3:5197978-5198000 AGTGCTGGGGGTGGGGTGAGGGG + Intronic
950249918 3:11456136-11456158 GGGCCAGAGGGTGGTGTGAGGGG - Intronic
950478815 3:13232224-13232246 AGGACAGTGGTGGGGCTGAGTGG - Intergenic
950482342 3:13252203-13252225 ACGCCAGGGGCTGAGGGGAGGGG - Intergenic
950501764 3:13368588-13368610 TGGCCAGGGACTGGAGTGAGGGG - Intronic
951043695 3:18015371-18015393 AGGTCACTGGTGGGGGTGAGGGG + Intronic
951563394 3:23989507-23989529 AGGCACAGGGTTGGGGAGAGGGG - Intergenic
951718507 3:25674040-25674062 AGGCCAGGGGTTGCTGAGGGTGG - Intergenic
951860497 3:27246678-27246700 TGGGCAGGGGTTGGGGGGATTGG - Intronic
952177877 3:30886512-30886534 AGGCCAAGGGATGGGGAGTGGGG + Intronic
952198005 3:31096386-31096408 AGGCCATGGGTATGGGTGAGAGG - Intergenic
952237814 3:31498454-31498476 AGCCAAGGGGTGGGGGTGGGGGG + Intergenic
952767894 3:36970866-36970888 AGGCCAAGGGTTGGGGGCATGGG - Intergenic
952897679 3:38089004-38089026 AGACCAGGAGTCGGGGAGAGTGG - Intronic
952941073 3:38444794-38444816 AGGCCAGGGGTGGGGGGGCATGG - Intergenic
953117642 3:40008988-40009010 AGGCCTGAGGTTGAGGTGACAGG + Intronic
953138060 3:40200775-40200797 AGGGCAGGGGTTGGGGTGAAGGG - Intronic
953337847 3:42109003-42109025 GGGCCAGGGGCAGGCGTGAGTGG + Intronic
953881195 3:46692347-46692369 GGGACAGGGGTTGGGGAGGGGGG - Intronic
954143848 3:48624355-48624377 AGGCCATGAGTTGGGGGGTGGGG + Intergenic
954148311 3:48645253-48645275 ATGCCTGGGGTAGGGGTCAGAGG - Intronic
954376230 3:50195462-50195484 AGGGCAGGGCTTGGGGTTGGGGG - Exonic
954412783 3:50378245-50378267 AAGCCAGGGGCTGGGAGGAGGGG + Intronic
954535753 3:51358182-51358204 GGGGCCGGGGTTGGGGAGAGAGG + Intronic
954615388 3:51966710-51966732 GGGCCAGGGATAGGGGAGAGAGG + Intronic
954620681 3:51993688-51993710 AGCCCAGGGGCGGGGGTGGGGGG + Exonic
954657020 3:52200329-52200351 TTGTCAGGGGTTGGGGAGAGAGG - Intronic
954811385 3:53250420-53250442 AGGGCTGGGGATGGAGTGAGTGG - Intronic
955026259 3:55170591-55170613 AGGGCAGGGAGTGGGGAGAGGGG + Intergenic
955059085 3:55481477-55481499 AGGGCAGGGGGTGGGGGGCGAGG + Intronic
955987411 3:64588462-64588484 ATGCCAGGGGTTGGGGGTTGGGG - Intronic
956121090 3:65966596-65966618 TGGGCAGGGGTAGGGGGGAGCGG + Intronic
956646985 3:71465975-71465997 ATGCGAGGGGTTGGGGGTAGTGG - Intronic
956774250 3:72551671-72551693 AGGCAAGAGGTTGCAGTGAGCGG + Intergenic
956903803 3:73744381-73744403 AGGCTGGGGGTGGGGCTGAGGGG + Intergenic
957041534 3:75339412-75339434 TGGCCAGGGGATGGGGTGGGAGG - Intergenic
957048734 3:75395985-75396007 AGCCCAGGGATGGGGTTGAGTGG + Intergenic
957507166 3:81136827-81136849 GGGCCTGTGGTGGGGGTGAGGGG - Intergenic
957535597 3:81498974-81498996 AGGAAAGGGGTTAGGGAGAGGGG - Intronic
958154932 3:89744405-89744427 ATCCCAGGGGCTGGGGTGTGAGG - Intergenic
959095524 3:101951360-101951382 AGGGCAGGGGTAGGGGAGCGGGG + Intergenic
959556996 3:107731657-107731679 GGGGCAGGGGTTGGGGGAAGAGG - Intronic
959777150 3:110180210-110180232 TTGCCAGAGTTTGGGGTGAGGGG - Intergenic
959877071 3:111395650-111395672 TTGCCAGGGGTTGGGGGCAGGGG - Intronic
960989601 3:123301908-123301930 AGCCCAGGGGTGGGGCGGAGCGG + Intronic
961449101 3:126994476-126994498 TGCCCTGGGTTTGGGGTGAGGGG + Intronic
961541013 3:127599378-127599400 CGGCCAGGGCTGGAGGTGAGAGG - Exonic
961635119 3:128328406-128328428 AGGCCATGGGATGAGGTGTGGGG + Intronic
961659916 3:128463245-128463267 TGGCCAGGGGTGTGGGTGAGAGG + Exonic
961669236 3:128517043-128517065 AGTCAAGGTGTTGGGGTGGGGGG - Intergenic
961744142 3:129052983-129053005 GGCCCTGGGGTGGGGGTGAGGGG + Intergenic
961828134 3:129609255-129609277 GAGCCAGGAGTTGGGGTGGGGGG + Intergenic
962251882 3:133840704-133840726 GGGCCAGAGGTGGGGGTGGGGGG - Intronic
962752458 3:138443898-138443920 GGGTCTGGGGTTGGGGTGGGAGG - Intronic
962939786 3:140115436-140115458 GAGCCAGAGGTGGGGGTGAGAGG - Intronic
963079066 3:141374553-141374575 TGGGGTGGGGTTGGGGTGAGGGG - Intronic
963348981 3:144130084-144130106 AGGTGAGGGGTTGGCGTGAAAGG - Intergenic
963737323 3:149034410-149034432 TTGCCAGGGGCTGGGGGGAGAGG + Intronic
964881043 3:161423210-161423232 GAGCCAGGGGTTGGGGAGTGGGG - Intergenic
965418514 3:168427135-168427157 ATGGCAGGGGTTGGGGGGTGAGG + Intergenic
965551307 3:169967232-169967254 AGGCCAGAGGATGGGGTGAAGGG - Intronic
965568456 3:170146951-170146973 AAGGCAGAGGTTGTGGTGAGCGG - Intronic
965675330 3:171189085-171189107 TTGCCAGGGGTTGGGGCAAGGGG - Intronic
965815261 3:172629606-172629628 GGGCCAGGGGATGGGGACAGTGG + Intergenic
966467959 3:180253160-180253182 ATGACAGGGATTGGGGTGACAGG + Intergenic
966914123 3:184575586-184575608 GGCCCCGGGGTAGGGGTGAGGGG + Intronic
966921035 3:184611488-184611510 TGGACAGAGGTTGGGGTGGGTGG - Intronic
967316458 3:188155090-188155112 AGGCAAGGGGTTGGGGATGGGGG + Intronic
967793427 3:193573036-193573058 GGGGCAGGGGTTGGGGGGAGGGG + Intronic
967846629 3:194048365-194048387 AGGCCACGTGATGGGGTGAGTGG - Intergenic
967893880 3:194382124-194382146 AGGCCAGATGCAGGGGTGAGGGG + Intergenic
967982354 3:195073234-195073256 AGGCCAGGGGACAGGGTGATCGG + Intronic
968039150 3:195573842-195573864 AAACCAGGAGTTGAGGTGAGTGG - Exonic
968081331 3:195848680-195848702 AGGCCAGGGGCTGGGGCGGGTGG - Intergenic
968082151 3:195854014-195854036 GGGGCAGGGGTGGAGGTGAGGGG - Intergenic
968289001 3:197524694-197524716 AGGCAATGAGTTGGGGTGGGGGG + Intronic
968298645 3:197596536-197596558 GGGGCAGGGGCTGGCGTGAGGGG + Intergenic
968310670 3:197681004-197681026 AGGGGAGGGGATGGGGGGAGGGG + Intronic
968484438 4:852160-852182 AGGCCAGGTGCTGGGGCGACGGG + Intronic
968530018 4:1086695-1086717 AGGACAGGGGTGGGGGTGAGAGG + Intronic
968530080 4:1086867-1086889 AGGACAGGGGTAGGGATGAGGGG + Intronic
968530150 4:1087074-1087096 AGGACAGGAGTGGGGGTGAGAGG + Intronic
968530191 4:1087189-1087211 AGGACAGAAGTGGGGGTGAGAGG + Intronic
968530244 4:1087342-1087364 AGGACAGAAGTGGGGGTGAGAGG + Intronic
968606474 4:1538009-1538031 CTGCCAGGGGTGGGGGTCAGGGG - Intergenic
968684917 4:1951592-1951614 AGGCCAGGCTGTGGGCTGAGGGG + Intronic
968717089 4:2168287-2168309 GGGACAGGCGCTGGGGTGAGAGG + Intronic
968774922 4:2535116-2535138 AGGACAGGGGTTGAGGCAAGGGG + Intronic
968899961 4:3426293-3426315 AGTGCAGGGGAGGGGGTGAGTGG + Intronic
969045963 4:4336959-4336981 GTGCCAGGGGCTGGGGTCAGGGG + Intergenic
969063761 4:4460846-4460868 TGGGCTGGGGTTGGGGAGAGGGG - Intronic
969131741 4:4995419-4995441 GGGCAAGGGGTTGGGGTTGGTGG - Intergenic
969528050 4:7714043-7714065 TGCCCATGGGTTGGGATGAGAGG + Intronic
969587546 4:8103152-8103174 AGCCCTGGGGTAGGGGTGTGGGG + Intronic
969597178 4:8156185-8156207 GGGGCAGGGGGTGGGGTGGGGGG - Intronic
969661575 4:8532666-8532688 AGCACTGGGGTGGGGGTGAGGGG + Intergenic
969686359 4:8676688-8676710 AGGCCAGGGGATGAGTTCAGAGG - Intergenic
969789205 4:9480463-9480485 GGGCCGGGGGATGGGGGGAGAGG - Intergenic
969916748 4:10498970-10498992 AGGACAAGGGTTGGGGGGGGGGG - Intronic
970723755 4:19018037-19018059 AGCCCAGGGCATGGGGGGAGTGG + Intergenic
970961078 4:21871772-21871794 AGGCGGGGGGTGGGGGTGGGTGG - Intronic
971177199 4:24292813-24292835 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177213 4:24292848-24292870 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177227 4:24292883-24292905 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177241 4:24292918-24292940 CAGGCAGGGGTGGGGGTGAGGGG - Intergenic
971177481 4:24293623-24293645 CAGGCAGGGGTAGGGGTGAGGGG - Intergenic
971253595 4:24993580-24993602 AAGTCATGGGTTGGGGTGGGAGG - Intergenic
971403661 4:26300242-26300264 TGGGCAGGGGTGGGGGTGGGTGG + Intronic
973027631 4:45292986-45293008 TGGCTAGGTGTAGGGGTGAGGGG + Intergenic
974145889 4:57946597-57946619 TGGCAAGGGGTTGGGGTGGGTGG + Intergenic
974243273 4:59280042-59280064 AGGGCATGTGTTGGGGTGTGGGG + Intergenic
975454152 4:74569747-74569769 TTGCCAGGGGTTGTGGGGAGGGG + Intergenic
975671691 4:76787018-76787040 AGGGCAGGGGTAGGGGTAGGTGG - Intergenic
976009605 4:80471567-80471589 AGGGCGGGGGTGGGGGTGGGGGG + Intronic
976267952 4:83203297-83203319 AGGTCTGGGGTGGGAGTGAGTGG - Intergenic
976421135 4:84845407-84845429 TGGCCAGGGGCTGAGGAGAGGGG + Intronic
976436565 4:85025201-85025223 CTGCCAGGGGTTGGGGGAAGAGG - Intergenic
976793704 4:88909423-88909445 TTGCCAGGGGTTGGGAGGAGTGG + Intronic
977091131 4:92677099-92677121 CTGCCAGGGGTTGGGAAGAGAGG + Intronic
977227799 4:94414236-94414258 AGGCCAGGGCTTGGGAGGTGAGG + Intergenic
978065992 4:104403260-104403282 TGGCCAGGGGTTAGGGAGAAGGG - Intergenic
978141273 4:105319935-105319957 TTTCCAGGGGCTGGGGTGAGAGG + Intergenic
978258154 4:106718065-106718087 AGGCCAGAGGATGGGAGGAGAGG - Intergenic
979054729 4:115979773-115979795 ACGCTTGGGGTTGGGATGAGGGG + Intergenic
979666705 4:123318679-123318701 CGGTCGGGGGTTGAGGTGAGAGG + Exonic
980631772 4:135446007-135446029 TTGCCAGGGGCTGGGATGAGGGG + Intergenic
980893564 4:138839712-138839734 AGGCCGGGGGCCGGGGTGGGAGG + Intergenic
982696552 4:158608799-158608821 TTGCCAGGGGCTGGGGAGAGGGG - Intronic
982758712 4:159254677-159254699 AAGACAGGGGTTGCAGTGAGCGG - Intronic
983109130 4:163726277-163726299 TTGCCAGAGGTTGGGGAGAGAGG - Intronic
983635807 4:169896775-169896797 AGGCCATGGGTTTGGAGGAGTGG + Intergenic
983843695 4:172488829-172488851 AGTCCTGGGGTGGGGGTGGGGGG + Intronic
983888197 4:173004338-173004360 AGTCCAGAGGTTGGGCAGAGTGG + Intronic
983944046 4:173566727-173566749 AGGGCTGGGGTTGGGGGGAAGGG - Intergenic
983944172 4:173567541-173567563 ATGCCAGGGGTGGTGGTGAAGGG + Intergenic
984674864 4:182535399-182535421 AGGCCAGGATTTGGGCAGAGAGG + Intronic
985471618 5:50509-50531 AGGGTAGGGGTTCGGGTTAGGGG - Intergenic
985804440 5:2031878-2031900 GGGGCTGGGGTTGGGGTGACAGG + Intergenic
985824992 5:2185184-2185206 GGGTCAGGGGTTAGGGTTAGGGG + Intergenic
985828719 5:2212741-2212763 AGGCCAGAGGGTGGGCAGAGAGG + Intergenic
986398422 5:7354489-7354511 TTGCCAGGGGTTGGGGGAAGTGG - Intergenic
986445135 5:7814944-7814966 AGGACATGGGTCGGGGGGAGGGG - Intronic
986822500 5:11482883-11482905 GGGCAAGGAGTTGGTGTGAGAGG + Intronic
987059860 5:14232306-14232328 ATGGGAGGGGTTGGGGGGAGTGG - Intronic
988264061 5:28927874-28927896 AGCCCAGGGATGGGGTTGAGTGG + Intergenic
988680601 5:33480949-33480971 AGGGGAGGGGATGGGGGGAGGGG - Intergenic
990380565 5:55218652-55218674 GAGGCAGGGGTTGGGGTGGGAGG - Intergenic
990438796 5:55822344-55822366 GGACCAGGGGTTGGTGTGTGGGG + Intergenic
990982415 5:61614115-61614137 TGGCCAGGAATAGGGGTGAGGGG + Intergenic
991003611 5:61806743-61806765 AATGCAGGGGTTGGAGTGAGGGG - Intergenic
991136325 5:63186133-63186155 TGCCCTGGGGTGGGGGTGAGAGG + Intergenic
991476326 5:67024062-67024084 TGGCCAGGGGTTGGGGGAGGGGG - Intronic
991620043 5:68535314-68535336 AGGCAGAGGGTTGGAGTGAGAGG - Intergenic
992104020 5:73436010-73436032 AGCCCAGACGTTGGGGTCAGCGG - Intergenic
992111589 5:73498858-73498880 AGGCCAGGGCCAGGGGTGGGGGG + Intronic
992219047 5:74553897-74553919 TTGCCAGGGGCTGGGGGGAGAGG - Intergenic
992252131 5:74886164-74886186 AGGGCAGAGGTTGCAGTGAGCGG + Intergenic
992334467 5:75751457-75751479 TTGCCAGGGGTTGGGGTTGGAGG + Intergenic
992562808 5:77968990-77969012 AGACCAGGGGTTGGGGCGGGGGG + Intergenic
993203997 5:84855801-84855823 TTGCCAGGGGTTGGGGCAAGGGG - Intergenic
993376555 5:87155536-87155558 AGGCCTTAGGTTGGGGTGAATGG + Intergenic
993411413 5:87578035-87578057 AGCCCATGGTTTGGGGTGTGAGG + Intergenic
993506395 5:88714273-88714295 TGGCAAGGGGTTGGGGAAAGAGG - Intergenic
993902718 5:93595573-93595595 AGGGAAGGGGGAGGGGTGAGAGG - Intergenic
994063137 5:95504076-95504098 AGGCGGGGGGTGGGGGTGGGGGG + Intronic
994075076 5:95641499-95641521 ATGTGAGGGGTAGGGGTGAGAGG + Intergenic
995481316 5:112595907-112595929 AGGGCAGGGGTTGGGGAGTTGGG - Intergenic
995495809 5:112741782-112741804 TTGCCAAGGGTTGGGGGGAGGGG - Intronic
995656831 5:114435135-114435157 AGGCCTGGTCCTGGGGTGAGGGG - Intronic
995846503 5:116499419-116499441 TGGCCGGGGGGTGGGGTGCGGGG + Intronic
995911808 5:117196600-117196622 AGGCGAGGGGTTGTGGGGACTGG + Intergenic
996348923 5:122517154-122517176 AGGCTAGGGGATGGGGTGAATGG - Intergenic
996585093 5:125078553-125078575 AGGCCAGGGTTTGGGGGAATGGG + Intergenic
997171052 5:131721321-131721343 TTACCAGGGGCTGGGGTGAGGGG + Intronic
997738009 5:136228618-136228640 AGGCAGGGGGCTGGGGTGGGGGG + Intronic
997980764 5:138466226-138466248 AGGGCAGGGGGTGGGCTGTGTGG - Intronic
998088029 5:139342439-139342461 AGGCTGGGGTTTGGGGAGAGAGG + Exonic
998183420 5:139961344-139961366 GGGGCAGGGATGGGGGTGAGGGG - Intronic
998366571 5:141636509-141636531 CGGCCGGGGGTTGGGGGGTGGGG - Intronic
998467304 5:142356652-142356674 AGGCCAGGGGATTGGGGGAGGGG + Intergenic
998771660 5:145552516-145552538 AGGCAGGGGGTTGGGGTGGAAGG - Intronic
998875355 5:146593670-146593692 ATGTCTGGGTTTGGGGTGAGGGG + Intronic
998889863 5:146734613-146734635 TGGCCAGGGGGTGGGGTGTCTGG - Intronic
998896462 5:146805328-146805350 ATGCCAAGAGTTGGGGGGAGGGG - Intronic
999152729 5:149437029-149437051 AGACCATGGGATGGGGTCAGAGG + Intergenic
999327662 5:150653064-150653086 GGGTCTGGGGTTGGGTTGAGTGG + Exonic
1000260713 5:159585785-159585807 AGGCCCAGAGCTGGGGTGAGGGG - Intergenic
1001104796 5:168843980-168844002 GGGCCAGGGGTAGGGGGGCGGGG - Intronic
1001115714 5:168937537-168937559 AGATAAGGGGTTGGGGTAAGGGG + Intronic
1001528308 5:172444825-172444847 AGGCCAGGGCTCGGGGCCAGAGG - Intronic
1001753036 5:174146042-174146064 AGCCCTGGGTTGGGGGTGAGCGG - Intronic
1001758001 5:174185693-174185715 AGGCCAGGGTGTGGGGTGTGTGG + Intronic
1001772024 5:174303848-174303870 TGGCCAGGGTCTGGTGTGAGGGG + Intergenic
1001801614 5:174549181-174549203 AGGCCTGGGATGGGGGTGGGTGG - Intergenic
1001803140 5:174560582-174560604 AGGTTGGGGGTGGGGGTGAGGGG - Intergenic
1001964120 5:175898377-175898399 GTGCCAGGGGCTGAGGTGAGGGG - Intergenic
1002197404 5:177508910-177508932 AGGCCAAGAGCTGGGGTGGGAGG + Intronic
1002418229 5:179132016-179132038 AGGCCAGGGTTTGGGATCAGAGG - Intronic
1002419824 5:179139679-179139701 CGGCCAGGGGAAGGGGTAAGAGG + Intronic
1002642420 5:180636553-180636575 AGGGCAGGAGCTGGGGTGGGGGG - Intronic
1002904262 6:1436170-1436192 TTGCCAGGGGCTGGGGAGAGGGG + Intergenic
1003135207 6:3429881-3429903 TTACCAGGGGCTGGGGTGAGTGG + Intronic
1003456828 6:6291241-6291263 AGGACAGGGGCACGGGTGAGGGG - Intronic
1003624247 6:7727675-7727697 GGCCCAGGGGATGGAGTGAGGGG + Intronic
1003873513 6:10419028-10419050 AGGCCTGGGGTTGTGGTGCGCGG - Intronic
1003884365 6:10507854-10507876 TTGCCAGGAGTTGGGGGGAGAGG + Intronic
1004327078 6:14685074-14685096 AGGCCAGGCCTTGCGCTGAGTGG + Intergenic
1004350401 6:14885790-14885812 AGGCTCTGGGTTAGGGTGAGTGG - Intergenic
1004617785 6:17306900-17306922 AGGGCAGAGGTTGTAGTGAGCGG - Intergenic
1004699267 6:18063918-18063940 AGGCCAAGGGGTGGGGGGGGGGG - Intergenic
1004792689 6:19044905-19044927 TTGCCAGGGGTTGGGGAGGGGGG - Intergenic
1005039529 6:21588495-21588517 GGGCCAGGGGATGGGGTAGGAGG + Intergenic
1005496341 6:26391347-26391369 GGGGAAGGGGTTTGGGTGAGTGG + Intronic
1005679263 6:28189359-28189381 AGACCTGGGAGTGGGGTGAGTGG + Intergenic
1005861686 6:29907338-29907360 AAGCCAGGGGGTGGGGGAAGAGG - Intergenic
1006383202 6:33712926-33712948 TTGCCAGGGGCTGGGGGGAGAGG - Intergenic
1006459092 6:34147990-34148012 GGGGCAGGGGGTGGGGAGAGTGG - Intronic
1006534594 6:34688111-34688133 AGGCCAGGGGTGGGGGTTGGGGG + Intronic
1006830257 6:36964071-36964093 TGGCCAGAAGTTGGGGTGAAGGG - Intronic
1006874677 6:37285092-37285114 AGGCCAGGGGTTGCAGAAAGTGG + Intronic
1006882784 6:37354304-37354326 AGGGCAGGGGCTGGAGGGAGCGG + Intronic
1007371360 6:41428451-41428473 AGCCCTGGGGTGGGGGTGTGGGG - Intergenic
1007421490 6:41722465-41722487 GGGGCAGGGGTGTGGGTGAGGGG + Intronic
1007425139 6:41741723-41741745 AGGCAGTGGGTGGGGGTGAGCGG - Intronic
1007578324 6:42940096-42940118 GTGCCAGGGGTTGGGGGAAGAGG - Intergenic
1007815019 6:44515889-44515911 TTACCAGGGGTTGGGGTGGGAGG - Intergenic
1007929376 6:45676631-45676653 AAACCACGGGTTGGGGTGAGGGG + Intergenic
1008594863 6:53031902-53031924 GAGGCAGAGGTTGGGGTGAGCGG - Intronic
1008661898 6:53677347-53677369 GTGCCAGGGGCTGGGGCGAGGGG - Intergenic
1010801649 6:80183749-80183771 TTGCCAGGGGTTGAAGTGAGGGG - Intronic
1011198835 6:84812090-84812112 AGGCCAGGGTGTAGGGGGAGAGG + Intergenic
1011275033 6:85622412-85622434 AGGGCCGGGGTTGGGGTGGGGGG - Intronic
1011349716 6:86409022-86409044 AGGCCTGGGGTGGGGGTAGGGGG + Intergenic
1011658316 6:89571933-89571955 TTGCCAGGGATTGGGGTGGGAGG - Intronic
1011670625 6:89679899-89679921 GGCCTAGGGGTGGGGGTGAGTGG - Intronic
1011814426 6:91171763-91171785 AGGGCAGGGGGTGGGGTCCGGGG + Intergenic
1013110082 6:107058006-107058028 ATGCCAGGGGCTGAGGTGATGGG - Intergenic
1014146090 6:117999487-117999509 AGCCCAGGGGTGGGGGTGGGGGG - Intronic
1014267677 6:119299883-119299905 GGGCCAGAGGTTGGGGTTGGTGG - Intronic
1015407832 6:132857295-132857317 AGGCAAGGAGGTGGGGAGAGTGG + Intergenic
1015644528 6:135371802-135371824 AGGCAAAGGGTTGGGGTGGGAGG + Intronic
1015790222 6:136958036-136958058 AAGCAAGGGGTTGGCGTGGGGGG - Intergenic
1015936969 6:138414121-138414143 AAGCCAGGGGCAGAGGTGAGGGG + Exonic
1016329729 6:142944510-142944532 AGGCGGGGGGTGGGGGTGAAAGG + Intronic
1016632599 6:146249829-146249851 CAGCCAGGGGGTGGGTTGAGAGG + Intronic
1016873097 6:148838208-148838230 AGGCCTGAGGGCGGGGTGAGAGG + Intronic
1017154763 6:151312861-151312883 ATGGCAGGAGATGGGGTGAGGGG + Intronic
1017432872 6:154388170-154388192 TGGCCAGGGGCTGAGGGGAGTGG - Exonic
1017656931 6:156638687-156638709 TGGCTAGGGGCTGGGGAGAGGGG + Intergenic
1017790118 6:157790541-157790563 AGGGCTGGGGGTGGGGGGAGTGG - Intronic
1017959725 6:159211048-159211070 ACGCCGGGGGTGGGGGTCAGGGG - Intronic
1018054617 6:160041154-160041176 AGGACAGGGGTTGTGCTGTGGGG - Intronic
1018454712 6:163941534-163941556 GGGCCTGGGGTTGGGGTGTGGGG + Intergenic
1018560798 6:165099263-165099285 ATGCCAGGGGTTTTGGGGAGGGG - Intergenic
1018611783 6:165654336-165654358 AGGGGTGGGGTTGGGGAGAGCGG - Intronic
1018696713 6:166396595-166396617 GGGGCGGGGGTGGGGGTGAGGGG + Intergenic
1018706489 6:166467454-166467476 AGGCCGGGGGCTGGGGTGCTGGG + Intronic
1018803567 6:167241491-167241513 AGGCCAGGGAGGGAGGTGAGAGG - Intergenic
1018806643 6:167267012-167267034 AGGCCAGGGAGGGAGGTGAGAGG + Intergenic
1018935042 6:168268793-168268815 AGGACTGGGGGTGGGGAGAGAGG + Intergenic
1018971943 6:168536162-168536184 AAGCCCTGGGTTGAGGTGAGGGG + Intronic
1019003364 6:168775243-168775265 AGACCAGGGGTTGCTGAGAGAGG + Intergenic
1019061325 6:169260140-169260162 AGGGCAGGGGATAGGGGGAGGGG - Intergenic
1019319113 7:407327-407349 GTGCCAGAGGCTGGGGTGAGAGG + Intergenic
1019327519 7:445669-445691 AGGCCAGGGGCTGCAGAGAGTGG - Intergenic
1019360507 7:602154-602176 AGGGCAGGGGCTGGGCTGGGAGG + Intronic
1019486307 7:1291014-1291036 AGGCTCGGGGTGGGGGTGGGGGG - Intergenic
1019516057 7:1440694-1440716 AGGCAAGGGGTCTGGGTGTGAGG + Intronic
1019523134 7:1469398-1469420 AGGCCAGGGGCTGGGCTGGGAGG + Intergenic
1019541698 7:1554597-1554619 AGGGCAGGGGCTGGGCAGAGAGG - Intronic
1019786443 7:2980406-2980428 GGGCCAGGTGCTGGGGAGAGGGG + Intronic
1019790442 7:3009213-3009235 TGGCCATGGAATGGGGTGAGGGG - Intronic
1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG + Intronic
1020088289 7:5323333-5323355 AGGACAGGTGTGGGGGTGGGGGG - Intronic
1020113321 7:5460522-5460544 AAGGCAGAGGTTGCGGTGAGCGG - Intronic
1020184785 7:5950733-5950755 AGGGTAGGGCATGGGGTGAGTGG - Intronic
1020298131 7:6774011-6774033 AGGGTAGGGCATGGGGTGAGTGG + Intronic
1020899827 7:13990597-13990619 AGCCCAGGGTTGGGGGCGAGCGG + Intronic
1021550684 7:21868053-21868075 AGGGCAGGGGTGGGGGTGAAAGG - Intronic
1021985488 7:26094299-26094321 AGGCGAGGAGTTGGGGGGAATGG - Intergenic
1022192458 7:28029905-28029927 AGTCAAGGGGTTGAGGTGAATGG + Intronic
1022503049 7:30894506-30894528 GGGGCAGGAGATGGGGTGAGTGG - Intergenic
1022968381 7:35495211-35495233 TGGCCAGGGGCTGGGGGCAGGGG - Intergenic
1022976357 7:35560422-35560444 AGTCCAGGGGTTGGGTGCAGTGG - Intergenic
1023612634 7:41986846-41986868 AGGCGTGGGGTGGGGGTGGGGGG - Intronic
1024096552 7:45987123-45987145 AGCCCAGGGTTGCGGGTGAGTGG + Intergenic
1024480515 7:49857187-49857209 TTGCCAGGGGTTGGGGGTAGGGG - Intronic
1025088592 7:56043651-56043673 GAGACAGGGGTTGGGGTGGGTGG - Intronic
1025665919 7:63583157-63583179 AGGACAGGTGTGGGGGTGGGCGG - Intergenic
1026004797 7:66592163-66592185 CGGGCCGGGGTTGGGGGGAGCGG - Intergenic
1026184205 7:68069277-68069299 TTACCAGGAGTTGGGGTGAGGGG + Intergenic
1026529728 7:71186396-71186418 AGGCCTGCGGCAGGGGTGAGAGG - Intronic
1026567394 7:71500848-71500870 AGGACAGGGGTTTGGAGGAGTGG - Intronic
1026573092 7:71548956-71548978 AAGCCAGGGAGTGGGGTGTGTGG + Intronic
1026857838 7:73766721-73766743 GTGGCAGGGGTTGGGGTGAGGGG - Intergenic
1027247863 7:76379578-76379600 GGGCGAGGGGTTGGGGGGGGGGG + Intergenic
1028082400 7:86594753-86594775 AGGCTAGGGGTGGTGGTGGGGGG - Intergenic
1028758081 7:94461284-94461306 GGGCCAGGCGGTGGGGTGTGAGG - Intergenic
1029324390 7:99793551-99793573 ATGCCAGGGTCTGGGGAGAGGGG - Intergenic
1029459712 7:100687721-100687743 AGGCCATGGGTTGGGTTAGGAGG - Intronic
1029459845 7:100688261-100688283 AGGCCGGGGGTGGGGAGGAGGGG + Exonic
1029550716 7:101235834-101235856 TGGCCAGGGGCTGGGGTGCACGG + Intronic
1029551173 7:101237871-101237893 AGCCCAGAGGCTGGGGGGAGGGG - Intronic
1029723714 7:102388083-102388105 AGGCCAAGGCTTGGGGTGACAGG - Intronic
1029816519 7:103102004-103102026 ATGCCAGTGGTTGGGGGGCGGGG - Exonic
1030103271 7:105965202-105965224 AGCCCAGGTGTTGGAGTGTGAGG - Intronic
1031351824 7:120741978-120742000 GGGTCAGGGGTTGGGGTGGGTGG + Intronic
1031574374 7:123397801-123397823 ATGGCAGGGGTTGGGGCGTGTGG - Intergenic
1031934711 7:127724960-127724982 GGGGCAGGGGTTGGCGTGGGGGG - Intronic
1032398873 7:131610110-131610132 AGGACAGGGGTTGGGGTGGAGGG - Intergenic
1032473165 7:132192918-132192940 AGGCCATGGGATGGGGAAAGGGG + Intronic
1032580678 7:133100430-133100452 TTGCCAGGGGTTGGGGAGTGGGG + Intergenic
1033327278 7:140390253-140390275 AGGGCTGGGGGTGGGGTGTGTGG - Intronic
1033371777 7:140715425-140715447 AGGGATGGGGTGGGGGTGAGTGG - Intronic
1033423194 7:141220536-141220558 AGGCCTGGAGTAGGGGTGGGAGG + Intronic
1033463044 7:141564798-141564820 AAGGCAGAGGTTGTGGTGAGTGG - Intronic
1034125706 7:148669575-148669597 TTGCCAGGGGTTGGGGAAAGGGG - Intergenic
1034427877 7:151024054-151024076 GGGCCAGGGGTGGGGTGGAGTGG + Exonic
1034464163 7:151215940-151215962 AGGCCTGGGGTTGGGATCCGGGG - Intronic
1034536738 7:151730004-151730026 TTGCCAGGGGCTGGGGTCAGGGG + Intronic
1034823105 7:154235183-154235205 GTGCCAGGGGTTGGGGACAGAGG - Intronic
1034936423 7:155203405-155203427 GGGTCAGGGGTTGAGGTCAGTGG + Intergenic
1035512759 8:205508-205530 AGGGTTGGGGTTGGGGTTAGGGG - Intergenic
1035520796 8:273863-273885 AGGTGAGGGGTTGGGGTATGGGG + Intergenic
1035796119 8:2358488-2358510 TGGTCAGGGTTTGGGGTCAGTGG + Intergenic
1035846384 8:2869644-2869666 AAGACATGGGGTGGGGTGAGAGG - Intergenic
1035972178 8:4261394-4261416 TTGCCAGGGGCTGGGGAGAGGGG + Intronic
1036600483 8:10256134-10256156 TTGCCAGGGGTTGGGGGGGGAGG - Intronic
1036635440 8:10547283-10547305 AGGCCCGGTCTTTGGGTGAGGGG - Intronic
1036678039 8:10851165-10851187 GGCCCCGGGGTTGGGGGGAGGGG + Intergenic
1036721818 8:11182876-11182898 CTGCCAGGGGCTGGGGCGAGGGG - Intronic
1036726005 8:11221698-11221720 AGACCAGGCCTGGGGGTGAGGGG - Intergenic
1037185837 8:16062811-16062833 AGGAATGGAGTTGGGGTGAGAGG + Intergenic
1037682866 8:21112407-21112429 CTGCCAGGGGTTGGGGTGAGGGG + Intergenic
1037934893 8:22908999-22909021 AGGGCAGGGGTTGCAGAGAGAGG + Intronic
1038092685 8:24271499-24271521 AGGCAAGGGGTGGGGGAGGGTGG - Intergenic
1038420323 8:27430307-27430329 AGTCCTGTGGTGGGGGTGAGGGG + Intronic
1038450231 8:27634684-27634706 AGGGCAGGGCCTGGGCTGAGGGG - Intronic
1038498428 8:28023790-28023812 AGGATAGGGATTGGGGTGGGGGG - Intronic
1038706623 8:29899984-29900006 AGGCACGGGGTGGGGGTGTGGGG - Intergenic
1040001271 8:42578455-42578477 GGGGCAGAGGTTGTGGTGAGCGG + Intergenic
1040542981 8:48376297-48376319 TGGGCAGGGGCTGGGGTGAGAGG + Intergenic
1040616075 8:49039946-49039968 AAGCCAGGGGTTGGGGGAATGGG + Intergenic
1041049384 8:53918240-53918262 TTGCCAGGGGATGGGGTAAGGGG - Intronic
1041229611 8:55735603-55735625 AGCCTAGGGGTGGGGGTGGGGGG + Intronic
1041449842 8:57994779-57994801 CCGCCAGGGACTGGGGTGAGCGG + Exonic
1041985140 8:63912848-63912870 AGGGCTGGAGTTGGGGTGGGTGG - Intergenic
1042017863 8:64336901-64336923 AGGCCAGGGGCTGAGGTGTGAGG - Intergenic
1042177199 8:66048303-66048325 AGGCCTGGGGTTGGGGGAAAGGG + Intronic
1042364972 8:67925375-67925397 AGGGCGGGGGTGGGGGTGGGGGG - Intergenic
1042568792 8:70140272-70140294 GGGCCAGGAGTTGTGGGGAGGGG - Intronic
1042617815 8:70669307-70669329 AGGCCGGGGGGTGGGGGGGGCGG + Intergenic
1042875260 8:73435542-73435564 AGCCCAAGGGTGGGGTTGAGGGG - Intronic
1043183022 8:77108695-77108717 CTGCCAGGGGATGGGGGGAGGGG + Intergenic
1043268990 8:78305084-78305106 TGGGGAGGGGGTGGGGTGAGGGG - Intergenic
1043484737 8:80687872-80687894 ATCGGAGGGGTTGGGGTGAGAGG - Intronic
1044605778 8:94046011-94046033 AGGGCAGGGTTTGGTGTAAGTGG + Intergenic
1045248455 8:100463478-100463500 AGGACATGGGGTGGGTTGAGAGG - Intergenic
1045529006 8:102966569-102966591 TGGTCAGGGGTAGGGGTTAGGGG - Intronic
1045569439 8:103353889-103353911 AGGGCTGGGGGTGGGGGGAGGGG + Intergenic
1045790039 8:105972880-105972902 AGGCCAGGTCTTGGGTTGATGGG + Intergenic
1045850831 8:106696820-106696842 TGGCTAAGGGGTGGGGTGAGGGG - Intronic
1047213668 8:122859648-122859670 AGGCCATGGGGTGGGGAGCGTGG + Intronic
1047923726 8:129661518-129661540 TTGCCAGGGGTTGGGGGTAGTGG + Intergenic
1048301654 8:133255708-133255730 AGGGCAGGGGATGGGGCAAGAGG + Intronic
1048381790 8:133871831-133871853 AGGCCATGGGCTGCAGTGAGAGG + Intergenic
1048382926 8:133884115-133884137 AGAAAAGGAGTTGGGGTGAGGGG - Intergenic
1048982326 8:139709432-139709454 GGGCCAGGAGTTGGGGAAAGTGG + Intergenic
1049070608 8:140352694-140352716 TGGCCTGGGGAAGGGGTGAGTGG - Intronic
1049186306 8:141256015-141256037 AAGCCGAGGGTTGGGGTGATAGG - Intronic
1049245526 8:141560296-141560318 AGGAGAGGGGGTGGGGTGGGCGG + Intergenic
1049282862 8:141759405-141759427 AGGGCCGGGGCAGGGGTGAGCGG + Intergenic
1049447002 8:142635787-142635809 AGGCCAGGTGGTGGGCTGTGGGG - Intergenic
1049544251 8:143222012-143222034 AGGCCAGGGGCAGGGGACAGAGG - Intergenic
1049550991 8:143259611-143259633 AGGCCAGGGTTGGGGGCGGGGGG - Intronic
1049794125 8:144488801-144488823 AGCACAGGGGTTGGGGAAAGAGG + Intronic
1049873062 8:144996276-144996298 TAGCCACAGGTTGGGGTGAGGGG - Intergenic
1050078968 9:1894914-1894936 AGGGCAGAGGTTGCAGTGAGCGG - Intergenic
1050473403 9:6016353-6016375 TTGCCAGAGGTTGGGGGGAGGGG + Intergenic
1050634823 9:7600897-7600919 TTGCCAGGGGTTGGGGCAAGAGG + Intergenic
1051015452 9:12469450-12469472 AGGGTAGGGGTTGGGGGGTGGGG + Intergenic
1052265104 9:26562981-26563003 AGGCCGGGGGTGGGGGGGGGGGG + Intergenic
1052370026 9:27654155-27654177 AGGCCAGGGATGGGGGTGATGGG - Intergenic
1052514490 9:29462635-29462657 TGGTCAGGGAGTGGGGTGAGGGG - Intergenic
1052998792 9:34565935-34565957 AGGGCAGCAGTTGGGGTGGGGGG + Intronic
1053262359 9:36679418-36679440 TGGCCAGGGGCTGGGGGGTGGGG - Intergenic
1053297343 9:36924390-36924412 AGGCCCTGGGGTGGGGTGGGAGG - Intronic
1053536340 9:38930346-38930368 GGGCTAGGGGTTGGGGTAAATGG - Intergenic
1053603751 9:39636219-39636241 TTGCCAGGGGTTGGGGGTAGGGG + Intergenic
1053861628 9:42392575-42392597 TTGCCAGGGGTTGGGGGTAGGGG + Intergenic
1054249789 9:62706200-62706222 TTGCCAGGGGTTGGGGGTAGGGG - Intergenic
1054351222 9:64017876-64017898 GGGTCAGGGGTTGGGGTCTGGGG + Intergenic
1054563899 9:66740722-66740744 TTGCCAGGGGTTGGGGGTAGGGG - Intergenic
1054629794 9:67433602-67433624 GGGCTAGGGGTTGGGGTAAATGG + Intergenic
1054762376 9:69014443-69014465 TTGCCAGGGCTTGGGGTTAGGGG + Intergenic
1055065293 9:72112423-72112445 AGGCGAGAGGTTGCAGTGAGCGG + Intergenic
1056189530 9:84171239-84171261 AGGCCAGAAGTGGGGCTGAGTGG - Intergenic
1056214441 9:84394075-84394097 ATCCCAGGAGGTGGGGTGAGTGG + Intergenic
1056594097 9:87991288-87991310 TTGCCAGGGGTTTGTGTGAGGGG - Intergenic
1056723709 9:89093674-89093696 AGGACAGGGGCTTGGGGGAGGGG + Intronic
1056745285 9:89296235-89296257 AGGGCAGGTGTTGGGGGCAGAGG + Intergenic
1056986737 9:91370536-91370558 GGGCCAGGGGTGGGGGCGGGAGG + Intergenic
1057117449 9:92539352-92539374 AGGCAGTGGGTTGGGGTGGGGGG - Intronic
1057384961 9:94598897-94598919 CTGCCAGGGGTAGGGGTGTGGGG + Intergenic
1057442289 9:95091221-95091243 GGGTCATGGGTGGGGGTGAGGGG + Intergenic
1057995562 9:99819813-99819835 GCGCCGGGGGTCGGGGTGAGTGG - Intergenic
1058014004 9:100009473-100009495 ATGCCAGGGGGTGGGGAGAGGGG - Intronic
1058453465 9:105117710-105117732 AGGTGAGGGTTTGGGGAGAGAGG + Intergenic
1058972071 9:110092932-110092954 AGGGATGGGGTGGGGGTGAGCGG + Intronic
1059011650 9:110467937-110467959 AGGCAGGGGGTTGGGGTGGGAGG - Intronic
1060070545 9:120543215-120543237 AGTCCAGTGGTTGAGGTGAGAGG - Intronic
1060199954 9:121646514-121646536 TGGGCAGGGGTGGGGGTGGGGGG - Intronic
1060443575 9:123666040-123666062 TTGCCAGGGGTTGGGGAGACAGG + Intronic
1060518123 9:124278585-124278607 GGGCCAGGGGTGGGGGGGTGTGG - Intronic
1060834652 9:126745965-126745987 ATGCCAGGGGATGGGGGAAGGGG + Intergenic
1060863396 9:126974936-126974958 TGGGTAGGGGTTGGGGTAAGAGG - Intronic
1060867947 9:127014681-127014703 AGGCCTGGGGGTGGGGGGTGTGG + Intronic
1060937084 9:127522063-127522085 AGGCCAGGGGCTGGGGAGGCGGG + Intronic
1060975429 9:127762300-127762322 AGGCCATGCGGTGGGGGGAGTGG - Intronic
1061006558 9:127931371-127931393 GGGCCTGGGGTCAGGGTGAGGGG - Intergenic
1061015447 9:127978591-127978613 AGGCCAGGGGGCGGGGTGCGGGG + Intronic
1061083722 9:128387161-128387183 TGGCCAGAGGTTCGGGTGACAGG - Intronic
1061183431 9:129038080-129038102 CAGCCTGGGGTTGGGGTGAAGGG + Intronic
1061308495 9:129746757-129746779 ACTCCAGGGGTTGGGGTCATCGG - Intronic
1061331019 9:129893256-129893278 AGGCCTGGGGTCGGGATGGGTGG + Intronic
1061426872 9:130505021-130505043 GAGGCAGAGGTTGGGGTGAGCGG - Intergenic
1061637987 9:131927544-131927566 AGGAGAGGAGATGGGGTGAGAGG - Intronic
1061921196 9:133783463-133783485 TGGCCAGGGACTGGGGTGGGGGG + Intronic
1061945808 9:133907847-133907869 AGGAAAGGGGGTGGGGTGGGAGG - Intronic
1061985367 9:134127358-134127380 AGGCCAGGGCGTGGGGGCAGTGG - Intergenic
1061987244 9:134136634-134136656 CTGCCTCGGGTTGGGGTGAGCGG - Intronic
1062024365 9:134333439-134333461 GGGCCAGGGCTGGGGGTGATGGG + Intronic
1062153788 9:135034694-135034716 GTGCCAGGGGCTGGGGAGAGGGG - Intergenic
1062612192 9:137380337-137380359 CGGACGGGGGTTGGGGTGGGGGG - Intronic
1062739389 9:138159866-138159888 AGGGCTAGGGTTGGGGTCAGTGG + Intergenic
1203361072 Un_KI270442v1:219576-219598 AGGCAAGGGGTGGGGATGGGCGG + Intergenic
1186110859 X:6254784-6254806 AGGCCAGGGGTTGGAGGTTGCGG - Intergenic
1186374966 X:8988903-8988925 AGGCCCGGGGCTGGAGTTAGGGG + Intergenic
1186439819 X:9576170-9576192 AGGTGATGGGTTGGGGTTAGAGG + Intronic
1186624394 X:11277038-11277060 TTCCCAGGGGCTGGGGTGAGAGG - Intronic
1187078188 X:15957513-15957535 TTACCAGGGGCTGGGGTGAGGGG - Intergenic
1187279695 X:17848619-17848641 GGGGCAGGGGTAGAGGTGAGGGG - Intronic
1187346905 X:18473837-18473859 AGACCTGGGGGTGGGGAGAGGGG + Intronic
1187378775 X:18781164-18781186 AGGAGAGAGGTTGGGATGAGGGG + Intronic
1187533496 X:20116754-20116776 AGGCCGGTAGTTGGGCTGAGAGG + Exonic
1187859351 X:23666529-23666551 AGGCCAGGGGTTGGGTGATGGGG + Intronic
1187975959 X:24705695-24705717 AGGCCAGGGGCAGGGGAGGGGGG - Intronic
1188550408 X:31358128-31358150 AGCCTTGGGGGTGGGGTGAGGGG - Intronic
1188891896 X:35622058-35622080 TTGCCAGGGGTTGTGGGGAGGGG + Intergenic
1189251095 X:39601207-39601229 AAGCCTGGGGTTGGGGTGGGAGG - Intergenic
1189744224 X:44153621-44153643 GGCTCAGGGGATGGGGTGAGGGG + Intronic
1190359698 X:49637227-49637249 ATGCCAGGGGCTGAGGGGAGTGG + Intergenic
1191653904 X:63575284-63575306 ATGTCAGGGGGTGGGTTGAGGGG + Intergenic
1192133602 X:68575888-68575910 TTGCCAGGGTTTGGGGTAAGGGG + Intergenic
1192163427 X:68806690-68806712 CTGCCAGGGGTTGGAGGGAGAGG + Intergenic
1192218072 X:69177763-69177785 CCTGCAGGGGTTGGGGTGAGAGG - Intergenic
1192369352 X:70500361-70500383 TGGCCGGGGGTGGGGGTGAGGGG - Intronic
1192550135 X:72047120-72047142 TGGCCAGGGGTGGGGGTGCTGGG - Intergenic
1193137084 X:77984146-77984168 GGAGCAGGGGTTGGGGTTAGAGG + Intronic
1194730121 X:97443002-97443024 AGGCTGGGGGTGGGGTTGAGGGG - Intronic
1194906793 X:99586967-99586989 TTGCCAGGGGTTGGGGGCAGAGG + Intergenic
1195174820 X:102305364-102305386 TGGCCATGGGGAGGGGTGAGTGG - Intergenic
1195184045 X:102381729-102381751 TGGCCATGGGGAGGGGTGAGTGG + Intronic
1195584383 X:106548173-106548195 TGGCCAGGGGCTGGGATGTGGGG - Intergenic
1195691428 X:107628838-107628860 AGACTGGGGGTTGGGGGGAGAGG + Intronic
1195769609 X:108336463-108336485 TTGCCAGGGGCTGGGGAGAGAGG + Intronic
1196189303 X:112778461-112778483 AGGACAAGGGTTGTGGGGAGGGG - Exonic
1196842318 X:119870173-119870195 AGCCAAGGTGTTGGGGAGAGGGG - Intergenic
1196918373 X:120561546-120561568 AGGCGAGGGGGTGGGGGGGGTGG + Intronic
1197164777 X:123364954-123364976 AGGCTAGGGGGTGAGGAGAGAGG + Intronic
1197220097 X:123904004-123904026 TTGCCAGGGGTTGGGAAGAGAGG - Intronic
1197485746 X:127049371-127049393 GAGCCAGGGGTTGCAGTGAGTGG - Intergenic
1197619229 X:128728442-128728464 GGGCCAAGGGTTGTGATGAGGGG - Intergenic
1198370164 X:135982391-135982413 AGGGCGGGGGTTGGGGGGGGCGG + Intergenic
1198534039 X:137569216-137569238 CGGGCGGGGGTGGGGGTGAGGGG + Intronic
1198963713 X:142207123-142207145 AGGGCTGGGGTTGGGGCAAGGGG - Intergenic
1199265335 X:145821188-145821210 AGGGCAGGGGTGGGGGTGGGGGG - Exonic
1199544210 X:148990322-148990344 GTGTCAGGGGGTGGGGTGAGGGG - Intronic
1199754091 X:150848374-150848396 CTGCCAGGGGCTGGGGAGAGTGG + Intronic
1199765264 X:150936720-150936742 CTGCTGGGGGTTGGGGTGAGAGG - Intergenic
1199876377 X:151932183-151932205 AGGTCAGGGGATGGGGTGGGGGG - Intergenic
1199980327 X:152917206-152917228 AAGTCAGGGCTTGGCGTGAGTGG - Intronic
1200060880 X:153483273-153483295 GGGTCAGGGGTTGGGGTGAGGGG - Intronic
1200139104 X:153889084-153889106 AGGGCAGGGGGTGGTGGGAGTGG - Intronic
1202195606 Y:22296278-22296300 AGCCCAGGGCTGGGGCTGAGAGG + Intergenic