ID: 925959544

View in Genome Browser
Species Human (GRCh38)
Location 2:9003133-9003155
Sequence GGTGCGGAAGGCTGCGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925959544_925959547 -8 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959547 2:9003148-9003170 TCCGCACCCTTTCCACAACCCGG 0: 1
1: 0
2: 0
3: 4
4: 106
925959544_925959552 6 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959552 2:9003162-9003184 ACAACCCGGTCCATGCGCACCGG 0: 1
1: 0
2: 0
3: 1
4: 47
925959544_925959559 18 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959559 2:9003174-9003196 ATGCGCACCGGGGGCTGCTCCGG 0: 1
1: 0
2: 0
3: 6
4: 68
925959544_925959553 7 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959553 2:9003163-9003185 CAACCCGGTCCATGCGCACCGGG 0: 1
1: 0
2: 1
3: 5
4: 40
925959544_925959560 19 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959560 2:9003175-9003197 TGCGCACCGGGGGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 188
925959544_925959555 9 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959555 2:9003165-9003187 ACCCGGTCCATGCGCACCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 26
925959544_925959554 8 Left 925959544 2:9003133-9003155 CCCAAAGCGCAGCCTTCCGCACC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 925959554 2:9003164-9003186 AACCCGGTCCATGCGCACCGGGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925959544 Original CRISPR GGTGCGGAAGGCTGCGCTTT GGG (reversed) Intronic
907240718 1:53079482-53079504 TGTGGAGAAGGCTGGGCTTTGGG + Intronic
918489146 1:185061461-185061483 GGTGCTAAAGGCTGCACATTCGG - Intronic
922317360 1:224454570-224454592 GGTGAGGAAGGCTGCCCTTATGG + Intronic
1063361885 10:5466244-5466266 GCTGCTGAAGGCTGTGATTTAGG - Intergenic
1063425836 10:5949443-5949465 GGTGGGGGAGGCTGTGATTTGGG + Intronic
1072663759 10:97379644-97379666 GGTGCTGCAGGCTGTGCCTTTGG - Exonic
1084836682 11:71807130-71807152 GGTGTGGAAGGCTGGGCAATGGG - Intergenic
1085205931 11:74731747-74731769 GGTGGGGAAGGCTGAGCTGTCGG + Intergenic
1092210816 12:6645371-6645393 GGAGCAGAAGTCTGCCCTTTAGG - Intronic
1100668764 12:96786229-96786251 GGTGTGCAAGGCTGCGATCTTGG + Intronic
1105997753 13:25688328-25688350 GGTGCGTGAGGGTGGGCTTTGGG - Intronic
1106243693 13:27928990-27929012 GGTGCAGGAGGCTGCGCTGTTGG - Intergenic
1106404304 13:29460411-29460433 GTTGCTGATGCCTGCGCTTTAGG - Intronic
1109974064 13:69807891-69807913 GGTGCCCCAGGCTGCTCTTTTGG + Intronic
1116320181 14:43452961-43452983 GGTGCACAAGCCTGAGCTTTTGG - Intergenic
1118859716 14:69653216-69653238 GGTGGGAGAGGCTGCCCTTTTGG + Intronic
1119684986 14:76624331-76624353 GGTGAGGAGGGCAGGGCTTTGGG + Intergenic
1119950289 14:78737822-78737844 GGGGAGGATGGCTTCGCTTTTGG + Intronic
1124466834 15:29947860-29947882 AGTGCGGAAGGCTGGTCTCTGGG + Intronic
1127842787 15:62845426-62845448 GCTGCGGAGGGCTGGGCTCTGGG - Intergenic
1130938359 15:88488703-88488725 GGTGGGGGATGCTGCACTTTTGG - Intergenic
1132584587 16:700713-700735 GGCGGGGAAGGCGGCGCTTCCGG - Intronic
1136367587 16:29816071-29816093 GGCGCGGGAGGCTCCGCTCTAGG - Exonic
1139954497 16:70686620-70686642 GGTGCCCAAGGCTGGGCATTTGG + Intergenic
1142153088 16:88521296-88521318 GGAGGGGAAGGCTGGGCTTGGGG - Intronic
1143316287 17:6035839-6035861 GGTGCAGAAGGCTGGGCTCAGGG + Intronic
1147409969 17:40243353-40243375 AGTGGGGAAAGCTGCGTTTTGGG + Intronic
1148790973 17:50172389-50172411 GGGGAGGAGGGCTGCGCTTGTGG + Intronic
1159208582 18:65285938-65285960 GGGGCTGAAGGCTGCGCTGTCGG + Intergenic
1160567315 18:79795014-79795036 GGTGAGGAACGCTGCGGCTTAGG + Intergenic
1161390010 19:4015879-4015901 GGTGCGGAATGCTGGGCTGGGGG + Intronic
1165463826 19:35960190-35960212 GGTCCCGAAGCCTGCGCCTTGGG - Intergenic
1165783174 19:38445619-38445641 GGTTTGGAAGTCTGAGCTTTGGG - Intronic
1167211386 19:48136098-48136120 TGAGCGGACGGCTGCGCCTTGGG - Exonic
1167587090 19:50381328-50381350 GGCAGGGAAGGCTGCGCTCTGGG - Intronic
1167765916 19:51482426-51482448 GGTGCCGTAGCCTGCGCTTTAGG - Intronic
1168605286 19:57754120-57754142 GGTGAACAAGGCTGCGCTTATGG - Exonic
925959544 2:9003133-9003155 GGTGCGGAAGGCTGCGCTTTGGG - Intronic
928330732 2:30356123-30356145 TGTGAGGAAGGATGGGCTTTAGG + Intergenic
934576033 2:95402224-95402246 GCTGGGAAACGCTGCGCTTTGGG + Intergenic
937440137 2:121908327-121908349 GGTGCAGGAGGCTGGGCTGTGGG + Intergenic
943247299 2:185472815-185472837 TGTGTGGGAGGCTGCGCTTCTGG + Intergenic
947118341 2:226795128-226795150 GGTGGGGGAGGCTGCGGTTCAGG + Exonic
948478721 2:238237614-238237636 GGTGCGGGAGCCTGCCCTCTTGG - Intergenic
1175403551 20:58713611-58713633 GGTGGGGAAGGCAGCGCGTGGGG + Intronic
1176946061 21:14983169-14983191 GGTGCAAGAGGCTGAGCTTTTGG - Intronic
1178493594 21:33069979-33070001 GGTGCGGCTGGCACCGCTTTAGG - Intergenic
1179260291 21:39751724-39751746 AGTGGGGAAGTCTGGGCTTTTGG + Intronic
1180868980 22:19135350-19135372 GGTGAGGAGTGCTGCGCCTTGGG - Intronic
1184376605 22:44117390-44117412 GGTGGGGGAGGCAGCTCTTTGGG + Intronic
1184450884 22:44582158-44582180 GGTGGGGAAGGCTGGGTTTCAGG - Intergenic
1185243146 22:49757058-49757080 GGTGCGGATGCCAGTGCTTTGGG + Intergenic
955221549 3:57027363-57027385 GGTGTGGAAGGGTGGGCATTGGG - Intronic
963706928 3:148698964-148698986 GGTGCAGAAGGAGACGCTTTGGG - Intronic
969337565 4:6520641-6520663 GGTGAGGAAGGCTGCTGTTGGGG - Intronic
969703704 4:8781075-8781097 GGTGGGGAGGGCTGGTCTTTGGG + Intergenic
988605902 5:32678326-32678348 GGTGAAGAAGGCTGGGCTTCTGG - Intergenic
994232105 5:97318411-97318433 GGTGAAGATGGCTGGGCTTTTGG - Intergenic
999084859 5:148878473-148878495 GGTGAGTAAGGCTGAGCCTTGGG + Intergenic
1005935282 6:30516330-30516352 GGAGCGGCAGGAAGCGCTTTGGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007056645 6:38892553-38892575 GGTGAGGAAGGTTCAGCTTTGGG - Intronic
1014106483 6:117569650-117569672 GATGCGGAGGGCTGCACGTTGGG - Exonic
1017010225 6:150058299-150058321 GGGGCTGAAGGCTGCCCTGTGGG - Intergenic
1018050677 6:160005757-160005779 GGCGCGGAAGGCTGCAGTTGGGG - Intronic
1022645465 7:32225213-32225235 GGTGAGGCAGCCTGTGCTTTTGG + Intronic
1026444721 7:70474286-70474308 GGTGGGGAAGGCTGCCCTGGGGG - Intronic
1026846779 7:73703101-73703123 GGCGGGGAAGGCTGCGGCTTGGG - Intronic
1035911526 8:3571968-3571990 GTTTAGGAAGGCTGCGCTTTAGG - Intronic
1036275541 8:7348621-7348643 GGTGTGGAAGGCTGGGCAATGGG - Intergenic
1036345807 8:7961736-7961758 GGTGTGGAAGGCTGGGCAATGGG + Intergenic
1036841145 8:12122490-12122512 GGTGTGGAAGGCTGGGCAATGGG + Intergenic
1036862942 8:12368742-12368764 GGTGTGGAAGGCTGGGCAATGGG + Intergenic
1038303686 8:26379808-26379830 GGTGCTGACGGCTGCAGTTTTGG + Intergenic
1049331588 8:142056916-142056938 GGAGGGGAAGGGAGCGCTTTGGG - Intergenic
1049799695 8:144512052-144512074 GCTGGGGAAGGCTACGCTGTGGG + Exonic
1051171506 9:14322497-14322519 GGCGCGGAAGGGTGCGCTGCTGG - Intronic
1056092610 9:83219251-83219273 GCTGCGGAAGGCGGCGCCATCGG + Intergenic
1059396615 9:114038172-114038194 AGTGCAGAAGGCTGTGCTGTGGG - Intronic
1059705781 9:116822026-116822048 GATGAGGAAGGCTGGGCTCTGGG - Intronic
1059871600 9:118584426-118584448 GGGGCTGATGGCTGCTCTTTGGG - Intergenic
1061291055 9:129650481-129650503 GGTGGGCCAGGCTGGGCTTTGGG + Intergenic
1061860165 9:133463927-133463949 GGTGGGGAAGGCTGTTCATTGGG + Intronic
1189187343 X:39065590-39065612 GGAGCAGAGGGCTGCGCTGTGGG + Intergenic
1192172535 X:68865763-68865785 GGGGCAGGAGGCTGAGCTTTAGG + Intergenic
1199150340 X:144477496-144477518 GGTACGGAAGACTGTGCTTATGG - Intergenic