ID: 925959637

View in Genome Browser
Species Human (GRCh38)
Location 2:9003399-9003421
Sequence CCTTCCAGGGAGCGGCGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925959625_925959637 -5 Left 925959625 2:9003381-9003403 CCGGCTTGTTGCCCCCTCCCTTC 0: 1
1: 0
2: 3
3: 33
4: 367
Right 925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG 0: 1
1: 0
2: 0
3: 18
4: 182
925959621_925959637 25 Left 925959621 2:9003351-9003373 CCCAGGAGGGAGGGGGCTCTGGG 0: 1
1: 1
2: 6
3: 67
4: 583
Right 925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG 0: 1
1: 0
2: 0
3: 18
4: 182
925959623_925959637 24 Left 925959623 2:9003352-9003374 CCAGGAGGGAGGGGGCTCTGGGA 0: 1
1: 0
2: 5
3: 64
4: 673
Right 925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG 0: 1
1: 0
2: 0
3: 18
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925959637 Original CRISPR CCTTCCAGGGAGCGGCGGGT AGG Intronic
900243982 1:1629377-1629399 CCCTGCAGGGAGCGGCAGGCGGG + Exonic
900383846 1:2400175-2400197 CCTGGCAGGGAGCTGCGTGTGGG - Intronic
900766622 1:4510114-4510136 CCTTCCAGGGAGCACAGGTTTGG + Intergenic
901458645 1:9378216-9378238 CCTTCCAGCAAGCTGGGGGTGGG - Intergenic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
905548528 1:38818255-38818277 CCTTCCGCGGAGCGGCGCGCTGG + Intergenic
908379551 1:63583297-63583319 CCTTCAAGGCTGCGGAGGGTAGG - Intronic
909285524 1:73811803-73811825 CTGTCCAGGGAGCAGCGGGAGGG + Intergenic
910200068 1:84690310-84690332 CCCGCCAGGGAGGGGCGGGCGGG - Intronic
910387992 1:86705159-86705181 CTTCCCAGGGAGCGGCGGTTGGG - Intronic
912124887 1:106523604-106523626 CCCTGCAGGGAGCGGCGGTGGGG - Intergenic
918112902 1:181473257-181473279 CCTACCAGGGAGCTCAGGGTTGG + Intronic
919204603 1:194405899-194405921 CTTTTCAGGGAGTGGAGGGTGGG + Intergenic
919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG + Intronic
920078319 1:203353350-203353372 CCCTCCTGGAAGTGGCGGGTGGG - Intergenic
922882365 1:228990513-228990535 CCTGCCAGGGTGCGGTGTGTGGG - Intergenic
924508171 1:244705478-244705500 ACTGCCAGGGAGTGGAGGGTGGG - Intronic
924520235 1:244799981-244800003 TCTTCCCGGGAGAGGAGGGTGGG + Intergenic
1063216451 10:3930134-3930156 CCTGCCAAGGAATGGCGGGTGGG + Intergenic
1064892015 10:20186564-20186586 CCTACCAGAGGGCGGAGGGTGGG - Intronic
1066703867 10:38157030-38157052 CCTCCCAGGGAGTGGCGTGCAGG - Intergenic
1069583052 10:69578114-69578136 CCGCGCAGGGAGCGGGGGGTGGG + Intergenic
1072801961 10:98398359-98398381 CCCTCCAGGGAAAGGAGGGTGGG - Intronic
1072948791 10:99834767-99834789 GCTTCCAGGGAGTGAAGGGTGGG - Intronic
1073106864 10:101037068-101037090 CCTTGCAGAGAGCTGCAGGTGGG + Exonic
1073441629 10:103555782-103555804 CCGTCCCGGGAGAGGTGGGTAGG - Intronic
1073665427 10:105527129-105527151 CCTACCAGAGAGTGGAGGGTTGG + Intergenic
1074447581 10:113533241-113533263 GCTTCCAGGGAGCAGCTGGAAGG + Intergenic
1076653529 10:132006190-132006212 TCTTCTATGGAGCGGGGGGTGGG + Intergenic
1076883443 10:133250903-133250925 GCTTCCAGGGACCGGAGGGTCGG + Intergenic
1076883515 10:133251149-133251171 GCTTCCAGGGACCGGAGGGTCGG - Intergenic
1076900609 10:133335790-133335812 CCTGCCAGAGCGCGGCGGGTGGG - Intronic
1076999671 11:316280-316302 CCCTCCTGGGAGGGACGGGTAGG + Intergenic
1077006168 11:358288-358310 CCTTCCAGAGAGCGCGGGGTGGG + Intergenic
1077465272 11:2730963-2730985 GCTCCCAGAGAGCGGCGGCTGGG - Intronic
1077914998 11:6605659-6605681 CCTACCAGAGTGGGGCGGGTAGG - Intronic
1078126122 11:8565293-8565315 ACTTCCAGGGAGATGGGGGTTGG - Intronic
1078250687 11:9614189-9614211 CCTGCCCAGGAGCGGCGCGTGGG - Intergenic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1081891063 11:46542827-46542849 CCTCCCAAAGAGCGGCGGGTAGG + Exonic
1083302576 11:61746602-61746624 CCTTCAAGGGCGAGGTGGGTAGG - Exonic
1083540001 11:63505989-63506011 CTGTCCAGGGAGCTGGGGGTGGG + Intergenic
1084173627 11:67412228-67412250 CCTGCCATGGATCGGCGGGGAGG + Intronic
1084390426 11:68872174-68872196 TCTTCCCGGGGGCGGGGGGTGGG + Intergenic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1086760538 11:90625052-90625074 CCTACCAGAGAGTGGAGGGTAGG + Intergenic
1089189633 11:116644499-116644521 CCATCCGGGGAGGGGCGGGTGGG + Intergenic
1089438456 11:118493102-118493124 CCTTCGGGGGAGCTGCGGGAAGG - Exonic
1089573098 11:119422953-119422975 CTTTCCAGGCAGGGGCGGGAGGG - Intronic
1093498616 12:19784353-19784375 CCTTCACGGGAGAGGCGGGGAGG - Intergenic
1099833932 12:87882581-87882603 CCTACCAGAGAGTGGAGGGTGGG + Intergenic
1103620801 12:122186052-122186074 GCTTCCGGGGAGCAGGGGGTGGG + Intronic
1103946643 12:124531052-124531074 CTTCCCTGGGAGAGGCGGGTTGG - Intronic
1104190747 12:126479942-126479964 GCTTCCAGGGAGGGGCAGGGAGG - Intergenic
1104212155 12:126699203-126699225 CATTCCAGGTAGCAGCTGGTAGG + Intergenic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1107845069 13:44504216-44504238 GTTTCCGGGGAGGGGCGGGTGGG - Intronic
1110671993 13:78191432-78191454 CCTTCCAGAGATTGGCAGGTGGG + Intergenic
1113378242 13:109783364-109783386 CCCTCCAGGGACAGGCGCGTGGG + Exonic
1113769472 13:112898952-112898974 CCTCCCAGGGAGCACCGGGCAGG + Intronic
1115546172 14:34466550-34466572 CCTACCAGAGAGCTGGGGGTGGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1125421936 15:39512697-39512719 CCCTCCAGGGAGAGGAGAGTTGG - Intergenic
1127421519 15:58811004-58811026 GCTTCCAGGGAGGGAAGGGTAGG - Intronic
1127866584 15:63038156-63038178 GCTTCCTGGGGGCGGGGGGTGGG - Intergenic
1130093208 15:80838183-80838205 ACTCGCAGGGAGCGGAGGGTGGG + Intronic
1131261439 15:90890071-90890093 CCCTGCAGGCAGGGGCGGGTGGG - Exonic
1132557472 16:578956-578978 CCTCCCAGGGGGCGGTGGGGAGG - Intronic
1132560015 16:589366-589388 CCTCGGAGGGAGCGGCGGGGTGG - Exonic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132681561 16:1144546-1144568 GCTTCCAGGAAGCGCCGGGGAGG + Intergenic
1132765887 16:1534016-1534038 CATCCCAGGGAGCAGAGGGTGGG - Exonic
1134417757 16:14059374-14059396 CCTTCCAGGTAGCGGGGAGAGGG - Intergenic
1135461726 16:22649847-22649869 CCTTTCAGAGAGTGGAGGGTGGG - Intergenic
1135655921 16:24249484-24249506 CCTTCCAGGGGGCAGAGAGTAGG - Intergenic
1136630582 16:31487412-31487434 CCTACCAGGGAGGGGCGCGGAGG + Intronic
1140234309 16:73144725-73144747 CTTTGCGGGGAGGGGCGGGTAGG - Intergenic
1141430885 16:83969630-83969652 CCCTCCCGGGTGGGGCGGGTGGG - Intronic
1142141774 16:88475849-88475871 CCGTCCAGGGGGCCGAGGGTAGG - Intronic
1142874549 17:2843650-2843672 CCTTGCAGGGTGGGGCGGGGTGG + Intronic
1143016296 17:3892848-3892870 CCTGCAAGGGAGAGGCGGGGGGG - Intronic
1143167132 17:4902366-4902388 CCTCCCAGGCAGCGCCAGGTGGG - Exonic
1144656989 17:17043001-17043023 CCGTTCTGGGAGCCGCGGGTCGG + Intronic
1147498919 17:40943455-40943477 CCTTTCAGGGGAGGGCGGGTGGG - Intergenic
1148645878 17:49219518-49219540 CCTGCGAGGGAGCGGGAGGTAGG - Exonic
1149894532 17:60419356-60419378 CCTACCAGAGAGTGGAGGGTGGG + Intronic
1151888075 17:76934964-76934986 CCTTCCAGGGAGCAGGAGCTGGG + Intronic
1152382438 17:79949095-79949117 CCGTCCAGGGAACGGGGGTTGGG - Intronic
1152744065 17:82031264-82031286 CCTTCAAGGCAGCGGCGAGGAGG - Intergenic
1153801676 18:8676367-8676389 CATTTCAAGGAGCGGAGGGTCGG - Intergenic
1154142220 18:11834272-11834294 CCTGCTAGGGAGGGGCGTGTGGG + Intronic
1154412807 18:14150466-14150488 CCCTGCAGGGAGGGTCGGGTGGG + Intergenic
1157675128 18:49562872-49562894 GCTTGCAGGGAGCGTCTGGTGGG + Intronic
1160255980 18:77249619-77249641 CGTTCCAGGGCGCGCCGGGGTGG - Intergenic
1160497511 18:79383946-79383968 CCTGCCAGGGGGCTGCAGGTCGG - Intergenic
1160847566 19:1173307-1173329 GCTTCCAGGGACAGGCGGGAGGG - Intronic
1160860856 19:1236809-1236831 GTTGCCAGGGAGCGGCGGGGAGG + Intronic
1161216253 19:3096275-3096297 CTTTCCAGGGGGCCGCGGGTAGG + Intronic
1162918745 19:13888292-13888314 CGTTCCAGGACGCGGCGGCTGGG + Intronic
1163749261 19:19065564-19065586 CTTTGCAGGGAGCGGTGGGAGGG - Intronic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
926107584 2:10162087-10162109 CATCCCAGGCAGCGGCGGATGGG - Intronic
927250630 2:20992239-20992261 CCTCCCAGAGAGCTGAGGGTAGG + Intergenic
927886707 2:26723278-26723300 TCTTCCAGGGAGATGCGGGGTGG - Intronic
929882796 2:45851904-45851926 CCTGCCATGGAGAGGCAGGTGGG + Intronic
930014730 2:46962528-46962550 CCTTTGAGGGAGTGGCAGGTGGG + Intronic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
935361703 2:102251105-102251127 ACTGCCAGGGAGCTGCGGGGTGG + Intergenic
936471889 2:112806000-112806022 CCTTCCCCGGAGCTGTGGGTCGG + Intergenic
942311816 2:174663474-174663496 ACTTGCAGGGGGCGGCGGGGTGG - Intronic
946301703 2:218828061-218828083 CCCTGCAGGGAGGGGCGGGGAGG + Exonic
947765787 2:232636300-232636322 CCTTCCAGGGAGCAAGTGGTGGG - Intronic
948053151 2:234993084-234993106 CCTTCTGGGGAGCGCCCGGTGGG + Intronic
948490667 2:238310522-238310544 GCTTTCAGGGAGTGGCAGGTGGG + Intergenic
948850683 2:240703935-240703957 CATCCCAGGGAGCTGAGGGTTGG - Intergenic
1169115162 20:3059690-3059712 CCTTCCAGGGACCTGAGGATGGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174266431 20:49335547-49335569 CATTCCAGGGAGCTGCGGGCAGG + Intergenic
1176546968 21:8206336-8206358 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176554873 21:8250545-8250567 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176565919 21:8389383-8389405 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176573794 21:8433570-8433592 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1176938262 21:14892551-14892573 TCTTCCAGGGAGCGGGGTGTGGG + Intergenic
1177128673 21:17229278-17229300 CCTTCCTGGGAGCAGAGGATGGG - Intergenic
1177909740 21:27016437-27016459 CCTGTCAGGGGGCGGCGGGAGGG + Intergenic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180868095 22:19131117-19131139 CCTTCCAGCGGGCGGGGAGTGGG + Exonic
1181680900 22:24495218-24495240 CCTTCCAGGGCTTCGCGGGTGGG - Exonic
1181983386 22:26782213-26782235 CCCTCCAGGGATCAGCAGGTGGG - Intergenic
1185368704 22:50448599-50448621 CCTTCCAGCGCTCAGCGGGTTGG + Exonic
1203251843 22_KI270733v1_random:122621-122643 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1203259894 22_KI270733v1_random:167704-167726 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
954712992 3:52514169-52514191 GCCTCCAGGGAGCGGTTGGTGGG - Exonic
954715335 3:52524010-52524032 CCTTCCAGGTAGGGCTGGGTTGG + Exonic
955680614 3:61497051-61497073 CCTTTCAGAGAGCGGAGGGTGGG + Intergenic
956910401 3:73810157-73810179 CCTGCCAGAGGGTGGCGGGTGGG + Intergenic
960695089 3:120388154-120388176 CCTTCCAGAGACCAGGGGGTGGG - Intergenic
966886551 3:184380449-184380471 CCGTTCGGGGAGCGGCAGGTAGG + Exonic
969300691 4:6295258-6295280 CCTTCCAGGAAGCTGCAGGTGGG + Intronic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969652814 4:8477907-8477929 CCTTCCAGGAGGCGGCGGCAGGG - Intronic
973097576 4:46222361-46222383 CCTGTCAGGGAGTGGGGGGTTGG - Intergenic
975319365 4:72993228-72993250 CTTTCCAGGGAAGGGCTGGTCGG - Intergenic
977572956 4:98648755-98648777 CCCTCCAGGGAGCAACGGGAAGG + Intronic
981528672 4:145732646-145732668 CGTTCCTGGGCGGGGCGGGTGGG - Exonic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
991474430 5:67004334-67004356 CCTTCCAGGGTCCGGCTGGGAGG - Intronic
991598518 5:68329012-68329034 CCTTTCAGAGGGCGGAGGGTAGG + Intergenic
992776475 5:80093515-80093537 ACTTCCAGGGAGCAGGGGGCAGG + Intergenic
993701473 5:91123868-91123890 CCTAGCAGGGAGTGGAGGGTGGG + Intronic
993770271 5:91917361-91917383 CCGCACAGGGAGCGGCGGGCCGG + Intergenic
995486029 5:112640952-112640974 TCTTCCAGGCAGCAGCTGGTGGG - Intergenic
995957717 5:117798942-117798964 CCTTTCAGAGAGTGGAGGGTAGG - Intergenic
997867341 5:137476188-137476210 CCTACCAGAGAGTGGAGGGTGGG - Intronic
998206027 5:140157425-140157447 CCTGACAGGGGGCGGGGGGTGGG + Intergenic
999325087 5:150638861-150638883 GCTTCCAGGGAGCTGGGGCTGGG + Intronic
999410609 5:151346743-151346765 CTTTCCAGGGAGTGGGGAGTGGG - Intronic
1001333215 5:170777005-170777027 GCTTCCAGGGAGGGGCGGCCTGG - Intronic
1002277647 5:178114054-178114076 CTTTCCAGGGAGCAGCGCGCGGG + Intronic
1002350181 5:178577608-178577630 CCATCCAGGCAGCGGGGGGCAGG - Intronic
1002536044 5:179876111-179876133 CCTTGCAGGGAGGGGTGGCTGGG - Intronic
1002988611 6:2216837-2216859 CCTGCCCAGGAGAGGCGGGTGGG - Intronic
1006378221 6:33683509-33683531 ACTTCCAGGAAGGGGCTGGTTGG + Intronic
1013480683 6:110550395-110550417 CCTTCCCGGGAGAGCCAGGTGGG + Intergenic
1014809320 6:125867886-125867908 CCTTCCAGAAAGCTGGGGGTGGG + Intronic
1019269515 7:139230-139252 CCTTCCAGGGAGCACAGGCTGGG - Intergenic
1020933244 7:14427088-14427110 CCTGTCAGGGAGTGGGGGGTGGG + Intronic
1022104008 7:27185614-27185636 CCACCCGGGGAGCTGCGGGTGGG - Intergenic
1023481183 7:40636358-40636380 GCTTCCAGGGAGAGGTGGGGAGG + Intronic
1026338432 7:69414566-69414588 CCTTTCAGAGAGTGGAGGGTGGG - Intergenic
1027001283 7:74656685-74656707 CCTACCGAGAAGCGGCGGGTGGG + Intergenic
1034256047 7:149725121-149725143 CCTTCCAGGGAGCAGGGTGGGGG + Intronic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1038566309 8:28622636-28622658 CCTCCCAGGGGGCAGTGGGTGGG + Intronic
1039968826 8:42304634-42304656 GCTTCCAGGAAGCAGCGGGGAGG - Intronic
1043401766 8:79891620-79891642 CCTTCGAGGGAGCGGTGGCGAGG - Intergenic
1044674272 8:94714019-94714041 CCTTTCAGAGGGCGGAGGGTGGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049373457 8:142278450-142278472 CCTTCCTGGGAGCTGCTGGAAGG - Intronic
1049678440 8:143904024-143904046 GCTGCCAGGGAGCTGTGGGTTGG + Intergenic
1049785696 8:144449691-144449713 TCTCCCTGGGAGCGGCCGGTTGG + Exonic
1052746077 9:32442278-32442300 TCTTGCAGGGAGCGTGGGGTGGG - Intronic
1052792782 9:32891365-32891387 CCCTCCAGAGAGCTGTGGGTGGG - Intergenic
1053200621 9:36149463-36149485 CCTTGGAGGGAGGGGTGGGTAGG - Intronic
1053401241 9:37825565-37825587 CCTTCCAGAGAGTGGAGGGTGGG + Intronic
1059656866 9:116365334-116365356 CCTTCCCGGGAGGCGCGGGGAGG - Intronic
1059718374 9:116934607-116934629 CCTTTCAGGGAGTGGAAGGTGGG + Intronic
1060154232 9:121308139-121308161 CCTTCAAGGGAGCTGTGGGTTGG - Intronic
1061540044 9:131273321-131273343 GCTTCCTGGGAGGGGCGGCTTGG - Intronic
1062049442 9:134439473-134439495 GCTTCCAGGGTGCGGAGGGCCGG - Intronic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062436993 9:136550798-136550820 GCTTCCAGGGACAGGCAGGTGGG - Intergenic
1203468245 Un_GL000220v1:105772-105794 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1203476066 Un_GL000220v1:149744-149766 CCTTCCCCGGAGTGGGGGGTTGG + Intergenic
1185586107 X:1243101-1243123 CCTTCCTGGGCGGGGAGGGTGGG - Intergenic
1190879244 X:54481154-54481176 CCTTCCAGGGAGTGGGAGATAGG - Intronic
1197680848 X:129382837-129382859 CCTCCCAGAGAGCAGAGGGTGGG + Intergenic
1199932383 X:152536841-152536863 CCTTCCAGGGAGCTGTGACTTGG + Intergenic