ID: 925959863

View in Genome Browser
Species Human (GRCh38)
Location 2:9004080-9004102
Sequence GGCCGTCGCCGGAGAACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925959858_925959863 -8 Left 925959858 2:9004065-9004087 CCGAGGCGCGGCCCGGGCCGTCG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959848_925959863 18 Left 925959848 2:9004039-9004061 CCGTGCCGAGGACCCGGGCGAGG 0: 1
1: 0
2: 1
3: 11
4: 104
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959840_925959863 26 Left 925959840 2:9004031-9004053 CCCCTCCCCCGTGCCGAGGACCC 0: 1
1: 1
2: 1
3: 15
4: 200
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959845_925959863 21 Left 925959845 2:9004036-9004058 CCCCCGTGCCGAGGACCCGGGCG 0: 1
1: 0
2: 0
3: 12
4: 109
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959847_925959863 19 Left 925959847 2:9004038-9004060 CCCGTGCCGAGGACCCGGGCGAG 0: 1
1: 0
2: 0
3: 7
4: 92
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959851_925959863 13 Left 925959851 2:9004044-9004066 CCGAGGACCCGGGCGAGGGCGCC 0: 1
1: 0
2: 2
3: 23
4: 117
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959846_925959863 20 Left 925959846 2:9004037-9004059 CCCCGTGCCGAGGACCCGGGCGA 0: 1
1: 0
2: 1
3: 3
4: 62
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959854_925959863 5 Left 925959854 2:9004052-9004074 CCGGGCGAGGGCGCCGAGGCGCG 0: 1
1: 0
2: 0
3: 14
4: 263
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959842_925959863 24 Left 925959842 2:9004033-9004055 CCTCCCCCGTGCCGAGGACCCGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959853_925959863 6 Left 925959853 2:9004051-9004073 CCCGGGCGAGGGCGCCGAGGCGC 0: 1
1: 0
2: 1
3: 24
4: 222
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
925959841_925959863 25 Left 925959841 2:9004032-9004054 CCCTCCCCCGTGCCGAGGACCCG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925959863 Original CRISPR GGCCGTCGCCGGAGAACGGC TGG Intergenic
903168105 1:21535188-21535210 GGCAGACGCCTGAGAAAGGCTGG + Intronic
903516996 1:23917935-23917957 GGCTGTGGCAGGAGAATGGCAGG + Intergenic
903801290 1:25970364-25970386 GGCTGTGGCAGGAGAACTGCCGG + Intronic
906437780 1:45811732-45811754 GGCTGAGGCAGGAGAACGGCGGG - Intronic
914319670 1:146546860-146546882 GGCCGAGGCAGGAGAATGGCGGG + Intergenic
918015989 1:180632533-180632555 GGCCGGGGCCGGGGAACGGTGGG + Intronic
923400794 1:233614128-233614150 GGCCAACGCCGCAGACCGGCCGG - Exonic
1065186832 10:23176428-23176450 GGCCGTGGCAGCAGAACAGCTGG - Intergenic
1070066418 10:73039405-73039427 GGCTGAGGCAGGAGAACGGCAGG - Intronic
1076308642 10:129485388-129485410 GCCAGCCGCCAGAGAACGGCTGG - Intronic
1076651291 10:131990225-131990247 GGCTGAGGCAGGAGAACGGCAGG + Intergenic
1076674080 10:132138843-132138865 GGCCGAGGACGGTGAACGGCAGG - Intronic
1079128483 11:17734749-17734771 GCCCGTGTCCGGAGAGCGGCGGG + Intergenic
1083770980 11:64867316-64867338 GGCCGAGGCAGGAGAACTGCTGG + Intronic
1092357530 12:7809098-7809120 GGCTGTGGCAGGAGAATGGCAGG - Intergenic
1094564741 12:31590127-31590149 GGCCGGCACCGCAGAGCGGCAGG + Intronic
1094703843 12:32896476-32896498 GGGCGGCGCCGGGGAGCGGCGGG + Intronic
1097855229 12:64454775-64454797 GGCTGACGCAGGAGAATGGCGGG - Intronic
1102573284 12:113840627-113840649 GGCCGTGGCCGGAGAGCAGACGG + Intronic
1103509807 12:121466850-121466872 GGCCGTGGCCGGCGCCCGGCAGG + Intronic
1105611416 13:21973093-21973115 GGCTGAGGCCGGAGAATGGCCGG - Intergenic
1113962173 13:114132292-114132314 CGCGCTCCCCGGAGAACGGCTGG - Intronic
1114484246 14:23053661-23053683 GGCCCTCGCCGCAGATAGGCTGG + Exonic
1114626827 14:24135916-24135938 GCCCGCCGCCTGAGGACGGCGGG - Intergenic
1116104704 14:40487249-40487271 GGCTGAGGCAGGAGAACGGCTGG - Intergenic
1117777409 14:59197019-59197041 GGCCGAGGCAGGAGAATGGCGGG - Intronic
1131551747 15:93363444-93363466 GGCCGAGGCAGGAGAATGGCAGG - Intergenic
1135412952 16:22248761-22248783 CGCCGTCACCGGGGAATGGCTGG + Exonic
1141959183 16:87392804-87392826 GGCGGTGGCCGGGGTACGGCAGG - Intronic
1142174745 16:88639958-88639980 AGCCGTCGCGGGAGCAGGGCCGG - Exonic
1142179781 16:88662795-88662817 AGCCGTCGCGGGGGAACGGGTGG + Intronic
1143545615 17:7593414-7593436 GGCCGTGGCCGGAGGACAGGCGG - Exonic
1149555032 17:57567576-57567598 GGCAGTCGCCGGTTAACTGCCGG - Intronic
1152870722 17:82751789-82751811 GGCCGCCGCCGGAGGACAGCGGG - Intergenic
1157564737 18:48672409-48672431 GGCCGTCACTGGAGAGGGGCAGG + Intronic
1161683096 19:5690306-5690328 GGCCGTCTCTGGAGAGCAGCAGG + Exonic
1162306488 19:9877430-9877452 GGCCGAGGCAGGAGAATGGCTGG + Intronic
1163082587 19:14954424-14954446 GGGCGTGGCCGAAGAAAGGCTGG + Intronic
1166225771 19:41394275-41394297 GGCCGACGCAGGAGAATTGCTGG + Intronic
1167244192 19:48364066-48364088 GGCCGGCGGTGGAGAAAGGCAGG - Exonic
1167361894 19:49034485-49034507 GGCCGAGGCAGGAGAATGGCAGG + Intronic
1167364187 19:49046364-49046386 GGCCGAGGCAGGAGAATGGCAGG - Intergenic
925959863 2:9004080-9004102 GGCCGTCGCCGGAGAACGGCTGG + Intergenic
927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG + Intergenic
929809818 2:45180279-45180301 GGCCGTGGAGGAAGAACGGCAGG + Intergenic
936041784 2:109155401-109155423 GGCCGAGGCAGGAGAATGGCAGG - Intronic
936074405 2:109392617-109392639 GGCTGAGGCAGGAGAACGGCTGG - Intronic
937284564 2:120741842-120741864 GGCCGCCGCCGGCGAGTGGCGGG + Intronic
938157955 2:128957507-128957529 GGCTGTCACCTGAGAAGGGCTGG + Intergenic
938500478 2:131829407-131829429 GCCCGTCGCAGTAGAACGCCCGG + Intergenic
943481942 2:188429809-188429831 GGCTGAGGCAGGAGAACGGCGGG - Intronic
1170217454 20:13906777-13906799 GGCCGAGGCAGGAGAATGGCGGG - Intronic
1177701598 21:24646088-24646110 GGCTGAGGCCGGAGAATGGCGGG + Intergenic
1184342126 22:43891826-43891848 AGCCGGCGCCGGAGAAGGACAGG + Exonic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
949104971 3:192771-192793 GGCCGAGGCGGGAGAATGGCGGG + Intergenic
965232204 3:166068998-166069020 GGCTGACGCAGGAGAACGGCGGG + Intergenic
966846394 3:184134137-184134159 GGCGGGCGCCGGAGCACGACGGG + Intergenic
968351429 3:198056937-198056959 GGCTGAGGCAGGAGAACGGCGGG + Intergenic
972771195 4:42198607-42198629 GGCTGAGGCAGGAGAACGGCTGG + Intergenic
985205292 4:187529193-187529215 GGCTGAGGCAGGAGAACGGCGGG + Intergenic
985286176 4:188337999-188338021 GGCTGAGGCAGGAGAACGGCGGG + Intergenic
985696637 5:1344721-1344743 TGGCGTCGCCGGAGCACGGGCGG + Exonic
985945360 5:3177968-3177990 GGCCCTCGCAGGAGAAGGGCAGG - Intergenic
985963144 5:3318954-3318976 GGCCGTGGTTGGAGAACTGCCGG - Intergenic
1001561151 5:172669816-172669838 GGCCGGGGCCGCAGCACGGCCGG - Exonic
1005674220 6:28137300-28137322 GCCCGCCCCCGGAGAAAGGCGGG + Intergenic
1006694645 6:35920843-35920865 GGCCGGCGCCAGAGGACGCCCGG + Intronic
1006821746 6:36901769-36901791 GGCTGAGGCCGGAGAATGGCGGG - Intronic
1019828052 7:3300600-3300622 GGCCGGCGCTGGAGGAGGGCGGG - Intergenic
1023973121 7:45006442-45006464 GGCCGAGGCAGGAGAATGGCGGG - Intronic
1025150962 7:56549105-56549127 GGCTGAGGCAGGAGAACGGCAGG + Intergenic
1027483256 7:78725696-78725718 GGCTGAGGCAGGAGAACGGCGGG + Intronic
1032849002 7:135776289-135776311 GGCCGAGGCAGGAGAATGGCTGG + Intergenic
1050911164 9:11073216-11073238 GGCTGAGGCAGGAGAACGGCGGG - Intergenic
1059299908 9:113304019-113304041 GGCCGTGGCAGGAGAATTGCTGG - Intergenic
1061180173 9:129020767-129020789 GGCTGAGGCAGGAGAACGGCGGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062499219 9:136845161-136845183 GCCCGTCGCAGTAGAACGCCCGG - Exonic