ID: 925967178

View in Genome Browser
Species Human (GRCh38)
Location 2:9076911-9076933
Sequence AGCTACTCGGGACGCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925967172_925967178 7 Left 925967172 2:9076881-9076903 CCAGGTGTGCTGGCACACACACA No data
Right 925967178 2:9076911-9076933 AGCTACTCGGGACGCCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925967178 Original CRISPR AGCTACTCGGGACGCCGAGG TGG Intergenic
No off target data available for this crispr