ID: 925969766

View in Genome Browser
Species Human (GRCh38)
Location 2:9098241-9098263
Sequence GCCTCCTGGACCCACCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925969766_925969771 -7 Left 925969766 2:9098241-9098263 CCCTGATGGTGGGTCCAGGAGGC No data
Right 925969771 2:9098257-9098279 AGGAGGCAGGGACTCACCAGAGG No data
925969766_925969772 6 Left 925969766 2:9098241-9098263 CCCTGATGGTGGGTCCAGGAGGC No data
Right 925969772 2:9098270-9098292 TCACCAGAGGATCTGAAGCCTGG No data
925969766_925969776 23 Left 925969766 2:9098241-9098263 CCCTGATGGTGGGTCCAGGAGGC No data
Right 925969776 2:9098287-9098309 GCCTGGAAATCTGTCCACAGGGG No data
925969766_925969778 24 Left 925969766 2:9098241-9098263 CCCTGATGGTGGGTCCAGGAGGC No data
Right 925969778 2:9098288-9098310 CCTGGAAATCTGTCCACAGGGGG No data
925969766_925969774 21 Left 925969766 2:9098241-9098263 CCCTGATGGTGGGTCCAGGAGGC No data
Right 925969774 2:9098285-9098307 AAGCCTGGAAATCTGTCCACAGG No data
925969766_925969775 22 Left 925969766 2:9098241-9098263 CCCTGATGGTGGGTCCAGGAGGC No data
Right 925969775 2:9098286-9098308 AGCCTGGAAATCTGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925969766 Original CRISPR GCCTCCTGGACCCACCATCA GGG (reversed) Intergenic
No off target data available for this crispr