ID: 925971674

View in Genome Browser
Species Human (GRCh38)
Location 2:9110669-9110691
Sequence TGGTCTGAGGACGGCAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925971674_925971678 1 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971674_925971681 8 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971681 2:9110700-9110722 CTGAGCGTGCAAGAGGCTCAGGG No data
925971674_925971680 7 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971680 2:9110699-9110721 TCTGAGCGTGCAAGAGGCTCAGG No data
925971674_925971682 18 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971682 2:9110710-9110732 AAGAGGCTCAGGGCCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925971674 Original CRISPR TGGTCTGAGGACGGCAGCTC AGG (reversed) Intergenic