ID: 925971678

View in Genome Browser
Species Human (GRCh38)
Location 2:9110693-9110715
Sequence TCTGCCTCTGAGCGTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925971672_925971678 18 Left 925971672 2:9110652-9110674 CCCTGGAAGTTCTGCAGCCTGAG No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971671_925971678 19 Left 925971671 2:9110651-9110673 CCCCTGGAAGTTCTGCAGCCTGA No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971669_925971678 29 Left 925971669 2:9110641-9110663 CCACCTCAGGCCCCTGGAAGTTC No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971675_925971678 -8 Left 925971675 2:9110678-9110700 CCGTCCTCAGACCACTCTGCCTC No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971670_925971678 26 Left 925971670 2:9110644-9110666 CCTCAGGCCCCTGGAAGTTCTGC No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971673_925971678 17 Left 925971673 2:9110653-9110675 CCTGGAAGTTCTGCAGCCTGAGC No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data
925971674_925971678 1 Left 925971674 2:9110669-9110691 CCTGAGCTGCCGTCCTCAGACCA No data
Right 925971678 2:9110693-9110715 TCTGCCTCTGAGCGTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925971678 Original CRISPR TCTGCCTCTGAGCGTGCAAG AGG Intergenic